Alternative Content Formats

From BioDAS
Revision as of 07:44, 4 May 2012 by Andy.jenkinson (talk) (changed error handing)
Jump to: navigation, search

List of alternative content formats

Name MIME type Commands
das-xml application/xml all
das-json application/json sources,features,types
binary-bigwig application/octet-stream features
binary-bigbed application/octet-stream features

das-xml

The XML formats described in the DAS Specification.


das-json

This format is a native JSON encoding of the DAS data model. The design principle for this format is that the properties accurately match those in the specification wherever sensible, but are not bound by the restrictions or conventions of XML. Thus there are no distinctions made between elements/attributes/text content, and properties can be of any JSON data type. Whilst this means that implementing a reciprocal XML-JSON conversion function must be done explicitly for each DAS command, using DAS in Javascript web applications is more natural.

The properties present in the JSON model for each command mirror those in the DAS specification, with the same semantics applied to each property (e.g. whether properties are required or optional). Since this is a new format at for the avoidance of confusion, deprecated properties are not included. Some effort to consider potential future changes to the specification is made.

Currently, the das-json format is defined for the sources, features and types commands.

das-json sources command

{
    "sources" : [
        {
            "uri"         : "mygenes",
            "title"       : "My Genes",
            "description" : "A source that provides gene features",
            "doc_href"    : "http://myplace.com/info/mysource",
            "maintainer"  : {
                "email": "me@myplace.com"
            },
            "versions" : [
                {
                    "uri"          : "mysource",
                    "created"      : "2012-03-27T14:23:44Z",
                    "capabilities" : [
                        {
                           "type"      : "das1:sources",
                           "query_uri" : "http://myplace.com/das/mygenes"
                        },
                        {
                           "type"      : "das1:formats",
                           "query_uri" : "http://myplace.com/das/mygenes/formats"
                        },
                        {
                           "type"      : "das1:features",
                           "query_uri" : "http://myplace.com/das/mygenes/features"
                        }
                    ],
                    "coordinates" : [
                        {
                            "uri"        : "http://www.dasregistry.org/dasregistry/coordsys/CS_DS108",
                            "label"      : "NCBIM_37,Chromosome,Mus musculus",
                            "authority"  : "NCBIM",
                            "version"    : "37",
                            "source"     : "Chromosome",
                            "taxid"      : 10090,
                            "test_range" : "8:1,1000"
                        }
                    ],
                    "properties" : [
                        {
                            "name"  : "Some Key",
                            "value" : "Some Value"
                        }
                    ]
                }
            ]
        }
    ]
}

das-json features command

The below example is a contrived response for a request with four parameters segments: one valid segment, one an unknown segment (i.e. the annotation server doesn't recognise the segment ID), another an error segment (start > end), and an unknown feature.

{
    "href" : "http://myplace.com/das/mygenes/features?segment=8:1,1000&segment=foo:10,20&segment=21:5000,4000&feature_id=bar",
    "errors" : [
        {
            "type" : "unknown-segment",
            "id"         : "foo"
        },
        {
            "type" : "error-segment",
            "id"       : "21",
            "start"    : 5000,
            "stop"     : 4000,
        },
        {
            "type" : "unknown-feature",
            "id"       : "bar"
        }
    ],
    "segments" : [
        {
            "id"       : "8",
            "start"    : 1,
            "stop"     : 1000,
            "version"  : "xyz",
            "label"    : "Chromosome 8",
            "features" : [
                {
                    "id"          : "f1",
                    "label"       : "F1",
                    "start"       : 503,
                    "end"         : 512,
                    "orientation" : "+",
                    "phase"       : 0,
                    "score"       : "12.6",
                    "type"        : {
                        "id"         : "t1",
                        "cvId"       : "SO:0000704",
                        "label"      : "Gene",
                        "category"   : "transcription",
                        "reference"  : false,
                        "superparts" : false,
                        "subparts"   : false
                    },
                    "method" : {
                        "id"    : "genewise",
                        "cvId"  : "ECO:0000203",
                        "label" : "GeneWise"
                    },
                    "notes" : [
                        "Something of note",
                        "Something else of note"
                    ],
                    "links" : [
                        {
                            "href"  : "http://myplace.com/info/features/f1",
                            "label" : "More info about F1"
                        }
                    ],
                    "targets" : [
                        {
                            "id"    : "cloneA",
                            "label" : "Clone A",
                            "start" : 3,
                            "stop"  : 12
                        }
                    ],
                    "parents" : [
                        "f24",
                        "f36"
                    ],
                    "parts" : [
                        "f7",
                        "f12"
                    ]
                }
            ]
        }
    ]
}

das-json types command

The below example is a contrived response for a request for three segments: one valid, one an unknown segment (i.e. the annotation server doesn't recognise the segment ID), and another an error segment (start > end).

{
    "href" : "http://myplace.com/das/mygenes/types?segment=8:1,1000&segment=foo:10,20&segment=21:5000,4000",
    "segments" : [
        {
            "id"       : "8",
            "start"    : 1,
            "stop"     : 1000,
            "version"  : "xyz",
            "label"    : "Chromosome 8",
            "types"    : [
                {
                    "id"          : "t1",
                    "cvId"        : "SO:0000704",
                    "category"   : "transcription",
                    "count"       : 1
                },
                {
                    "id"          : "t2",
                    "cvId"        : "SO:0000147",
                    "category"   : "transcription",
                    "count"       : 6
                }
            ]
        },
        {
            "is_unknown" : true,
            "id"         : "foo",
            "start"      : 10,
            "stop"       : 20,
        },
        {
            "is_error" : true,
            "id"       : "21",
            "start"    : 5000,
            "stop"     : 4000,
        }
    ]
}

das-json sequence command

The below example is a contrived response for a request for two segments: one valid, one an error segment (e.g. the reference server doesn't recognise the segment ID, or some other error with the start or end). Note that reference servers never serve "unknown segments", so the sequence command does not use these.

{
    "href" : "http://myplace.com/das/mygenes/sequence?segment=8:10001,10060&segment=foo:10,20",
    "segments" : [
        {
            "id"       : "8",
            "start"    : 10001,
            "stop"     : 10060,
            "version"  : "xyz",
            "label"    : "Chromosome 8",
            "sequence" : "gcaattatgacacaaaaaattaaacagtgcagactgatatataaatcaaaacaaatgtcc"
        },
        {
            "is_error"   : true,
            "id"         : "foo",
            "start"      : 10,
            "stop"       : 20,
        }
    ]
}