Spec Review

From BioDAS
Revision as of 10:41, 9 October 2008 by Jw12 (talk) (Examples)
Jump to: navigation, search

Note: this is NOT the official version of the DAS specification.

Contents

Distributed Sequence Annotation System (DAS) Spec Review

Oct 1,2008

This is a working document and a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the <a href="http://www.dasregistry.org/spec_1.53E.jsp">1.53E spec</a> and some of the 2.0 spec. Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as alignments and protein structures. The spec also includes references to the DAS Registry which is essential for implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures.

Overview of the System

This section provides a high-level view of the system architecture.

System Components (Reference Servers, Annotation Servers and the DAS Registry)

The DAS system consists of the a reference server, one or more annotation servers and the das registry.

The Reference Server

Central to the DAS system is the idea of reference objects that can be served from a reference server. These are biological data objects with stable identifiers which are targets for annotation. In the original DAS protocol, the reference objects are always biological sequences: chromosomes, scaffold sequences from genome assemblies or protein sequences. When a DAS client starts, its first action is to connect to an appropriate reference server and retrieve the reference sequence. Once a reference object has been loaded, the DAS client will contact one or more annotation servers to obtain the data provided for the reference objects. Typical annotations might include sets of predicted exons on a genome sequence, or matches to a protein domain model on a protein sequence. It is the client's responsibility to collect all relevant annotations and display them in a user-friendly manner.

A coordinate system describes the data that is made available by a DAS source/reference server. This information is important for the DAS clients, to deal with data correctly, as they often can accept data served in multiple coordinate systems. The coordinate systems are described by four fields: Authority, (assembly) Version, Type, and Organism. The assembly version is important for genome assemblies, but not really applicable for other datasets like UniProt sequences, therefore this field is optional.

Annotation Server

Annotation servers are specialized for returning lists of annotations across a reference object served by the reference server. Each annotation can be anchored to the co-ordinate system map by way of a start and stop position relative to one of the reference objects.Annotations have an ID that is unique to the server and a structured description that describes its nature and attributes. Annotations may also be associated with Web URLs that provide additional human readable information about the annotation.

Annotations have types, methods and categories. The annotation type is selected from a list of types that have biological significance though these do not help the readability of xml returned so I can see why people are reluctant to adapt them), delete this EMBL bit? and correspond roughly to EMBL/GenBank feature table tags. Examples of annotation types include "exon", "intron", "CDS" and "splice3."(We encourage the use of the <a href="http://www.sequenceontology.org/">Sequence Ontology</a> Tip: We recommend OboEdit for looking up ontologies for regular use and the ontologies it uses can be downloaded from <a href="http://www.berkeleybop.org/ontologies/#ontologies">here</a> IDs to give uniformity to DAS sources for example CDS is SO:0000316 is there a better resource out there that you can go from id to name and desciption and visa versa??). The annotation method is intended to describe how the annotated feature was discovered, and may include a reference to a software program (we also encourage the use of ECO numbers to represent the method of annotation e.g.ECO:0000032 "inferred from curated blast match to nucleic acid). The annotation <a href="http://www.ebi.ac.uk/ontology-lookup/"> category is a broad functional category that can be used to filter, group and sort annotations. "Homology", "variation" and "transcribed" are all valid categories. The existence of these categories allows researchers to add new annotation types if the existing list is inadequate without entirely losing all semantic value. The <a href="#categories">Annotation Categories</a> section contains a list of the annotation types in use in the C. elegans project. <p> It is intended that larger annotation servers provide pointers to human-readable data that describes its types, methods and categories in more detail. Another optional feature of annotation servers is the ability to provide hints to clients on how the annotations should be rendered visually. This is done by returning a XML "stylesheet". <p> The co-ordinate system server is an annotation server that provides the following additional services:

  1. Given a reference sequence id, it can return the raw DNA of that sequence.
  2. Given a reference sequence id, it can return annotations of the category "component". Component annotations describe how the sequence is assembled from smaller parts into large parts from the top down.
  3. deprecate this?Given a reference sequence id, it can return annotations of the category "supercomponent". Component parent annotations describe the assembly of the sequence from the bottom up.

<p>

Although the servers are conceptually divided between reference servers and annotation servers, there is in fact no key difference between them. A single server can provide both reference sequence information and annotation information. The main functional difference is that the reference sequence server is required to serve the sequence map and the raw DNA, while annotation servers have no such requirement how to generalise this? What does not serve sequence info?.

<p>

The DAS Registry

central DAS registry which implements this protocol and fulfils the following roles:

1. It allows discovery of available DAS sources via a web page, or as machine-readable XML which can be used directly by DAS client programs.

2. It automatically validates registered DAS sources to ensure that they return well formed DAS XML.

3. It periodically tests DAS sources and notifies their administrators if they are unavailable.

4. It can group the registered DAS sources according to the coordinate systems of their data.

5. It can also communicate bi-directionally with DAS clients and activate or highlight DAS sources in clients.

The Co-ordinate System

The distributed annotation system (DAS) relies on there being a common "co-ordinate system" on which to base annotations. The co-ordinate system consists of a set of "entry points", and the lengths of each entry point but not all in the case of alignments??. The identity of an entry point will vary from co-ordinate system to co-ordinate system. For some projects, entry points correspond to entire chromosomes. For others, entry points may be a series of contigs or proteins or structures.

The entry points describe the top level items on the co-ordinate system. remove this section on subsequence?It is possible for each entry point to have substructure, basically a series of subsequences (components) and their start and end points. This structure is recursive. Each annotation is unambiguously located by providing its position as the start and stop positions relative to a "reference object." The reference object can be one of the entry points, or any of the subsequences within the entry point.

Client/Server Interactions

The DAS is Web-based. Clients query the reference and annotation servers by sending a formatted URL request to the server. This request must follow the conventions of the HTTP/1.0 protocol (see RFC2616. Servers process the request and return a response in the form of a formatted XML document (see W3C Extensible Markup Language).

The Request

All DAS requests take the form of a URL. Each URL has a site-specific prefix, followed by a standardized path and query string. The standardized path begins with the string /das. This is followed by URL components containing the data source name and a command. For example:


http://www.wormbase.org/db/das/elegans/features?segment=CHROMOSOME_I:1000,2000
^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
   site-specific prefix    das  data   command  arguments
                                 src 

In this case, the site-specific prefix is http://www.wormbase.org/db. The request begins with the standardized path /das, and the data source, in this case /elegans. This is followed by the command /features, which requests a list of features, and a query string providing named arguments to the /features command.

The data source component allows a single server to provide information on several genomes.

More information on the format of the request and the various available commands is given [#commands below].

The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.

SOAP has not been widely adopted for das so should we delete this? The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.

The Response

The response from the server to the client consists of a standard HTTP header with DAS status information within that header followed optionally by an XML file that contains the answer to the query. The DAS status portion of the header consists of two lines. The first is X-DAS-Version and gives the current protocol version number, currently DAS/1.0. The second line is X-DAS-Status and contains a three digit status code which indicates the outcome of the request.

Here is an example HTTP header: (provided by Web server)


HTTP/1.1 200 OK                          
Date: Sun, 12 Mar 2000 16:13:51 GMT          
Server: Apache/1.3.6 (Unix) mod_perl/1.19    
Last-Modified: Fri, 18 Feb 2000 20:57:52 GMT 
Connection: close                            
Content-Type: text/plain                     
X-DAS-Version: DAS/1.5
X-DAS-Status: 200
X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
data follows...

The defined status codes are listed in Table 1.

Table 1: DAS response codes
200 OK, data follows
400 Bad command (command not recognized)
401 Bad data source (data source unknown)
402 Bad command arguments (arguments invalid)
403 Bad reference object (reference sequence unknown)
404 Bad stylesheet (requested stylesheet unknown)
405 Coordinate error (sequence coordinate is out of bounds/invalid)
500 Server error, not otherwise specified
501 Unimplemented feature

The HTTP/1.0 protocol allows web clients to request byte-level compression of the response by sending the HTTP header Accept-Encoding header. Web servers that are capable of it can reply with a Content-transfer-encoding header and a compressed body. Implementors of DAS clients and servers may wish to implement this HTTP feature.

New in version 1.5

The X-Das-Capabilities header provides an extensible list of the capabilities that the server provides. This can be used by those writing experimental extensions to DAS to flag clients that those extensions are available. Capabilities have the form CapabilityName/Version and are separated by semicolon, space, as in "capabilityA/1.0; capabilityB/1.4; capabilityC/1.0". The following standard capabilities are present in the DAS/1.5 protocol:

Capability Name Description
dsn/1.0 The server supports the basic dsn request.
dna/1.0 The server supports the basic dna request.
types/1.0 The server supports the basic types request.
stylesheet/1.0 The server supports the basic stylesheet request.
features/1.0 The server supports the basic features request.
entry_points/1.0 The server supports the basic entry_points request.
error-segment/1.0 Server will report requests for invalid segments with an <ErrorSegment> response.
unknown-segment/1.0 Server will report requests for unknown or unannotated segments with an <UnknownSegment> response.
unknown-feature/1.0 Server will report requests for unknown features with an <UnknownFeature> response.
feature-by-id/1.0 The features request will accept the CGI parameter "feature_id", enabling the server to look up segment(s) based on the ID of a feature.
group-by-id/1.0 The features request will accept the CGI parameter "group_id", enabling the server to look up segment(s) based on the ID of a group.
component/1.0 The features request will return components of the indicated segment when a category type of "component" is requested.
supercomponent/1.0 The features request will return supercomponents of the indicated segment when a category type of "supercomponent" is requested.
sequence/1.0 The server supports the new sequence request.

Reference sequence IDs

Reference sequence IDs indicate a segment of the genome. They can correspond to low-level primary sequences such as sequenced clones, or to higher-level assemblies such as contigs.

A reference ID can contain any set of printable characters (including the space character), but not the colon character (":"), which is reserved for separating reference IDs from sequence ranges (see below). The newline, tab and carriage return characters are also reserved for future use.

A data source that uses the colon character for its internal IDs must map this character to another one on the way out and on the way in. For example:


   Client request       server's internal id         Response to client

   gi-123456       -->  gi:123456                    --->  gi-123456

   gi-123456:1,1000 --> gi:123456 start=1 stop=1000  --->  gi-123456:1,1000


The Queries

This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as PREFIX. The other meta-variable used in these examples is DSN, which is a symbolic data source. (As seen the the [#request above example.]) Data sources are standardized across DAS servers in such a way that a data source name has a one-to-one correspondence with a reference sequence.

Retrieve the List of Data Sources (sources cmd)

DSN command has been deprecated in favour of this sources cmd

Scope: Reference and annotation servers.

Command: Sources

Format:


PREFIX/das/sources

Description: This query returns the list of data sources that are available from this server. In particular the following information for a DAS server is important:

  • The email address of the maintainer of a DAS source
  • The <a href="help_coordsys.jsp">coordinate system</a>(namespace) of the provided data
  • different properties that allow to describe a server closer


Scope: all DAS servers


Command: sources


Format:


<i>PREFIX</i>/das[1]/sources

The PREFIX can be either das or das1 in order to refer to the major version 1 of the DAS protocol and in order to provide support for the future das2 protocol.


Description: This query returns the meta information for a DAS server
Arguments: none

Response:



The response to the sources command is the "DASSSOURCE" XML-formatted document:

<?xml version='1.0' encoding='UTF-8' ?>
<?xml-stylesheet type="text/xsl" href="das.xsl"?>
<SOURCES>
 <SOURCE uri="URI" title="title" doc_href="URL" description="description">
    <MAINTAINER email="email address" />
    <VERSION uri="URI" created="date">

      <COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string</COORDINATES>      
      <CAPABILITY type="das1:command" query_uri="URL" />
      <PROP name="key" value="value" />     
     </VERSION>
   </SOURCE>
</SOURCES>



Format:

xml-stylesheet optional an XSL stylesheet that e.g. allows a browser to nicely display the XML response
SOURCES mandatory the main container for several DAS sources
SOURCE mandatory, one or many the description for a DAS datasource
uri mandatory a unique URI for the DAS source
title, description mandatory the nickname under which a DAS server shall be known and displayed in a view. The description is a free text description of the provided data
doc_href optional points to a web site where more information about a DAS source can get obtained.
MAINTAINER, email mandatory the email address of the maintainer of this DAS source.
VERSION mandatory in principle this would allow hosting several versions of a DAS sources (with unque uris)

on a server, but in practise most people provide only the server with the latest data. the created attribute provides the date on which a DAS server has been set up initially. For a DAS registation server this is the date at which a DAS server has been pulished.

COORDINATES mandatory, one or many The description of the namespace of a DAS source.

uri - the unique URI for a DAS source. For a DAS registration server these should be resolvable and allow to access more information about this. e.g. <a href="http://www.dasregistry.org/dasregistry/coordsys/CS_DS6">http://www.dasregistry.org/dasregistry/coordsys/CS_DS6</a> for the UniProt,Protein Sequence coordinate system.

source - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available: Chromosome, Clone, Contig, Gene_ID, NT_Contig, Protein Sequence, Protein Structure

authority - the authority, or institution that assigns the accession code for this namespace. In case of genome assemblies the authority that builds the assembly.


version - (optional) for genome assemblies the version of the build.
To learn more about coordinate systems, please see <a href="help_coords.jsp">here</a>.

CAPABILTIY mandatory, one or many The supported DAS commmand

type - the type of the DAS command. to distinguish DAS/1 from DAS/2 servers das1: is used before the name of the command.
query_urithe URL of the server location, with the command attached. e.g. http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/features

Note: For some DAS commands this will not resolve, since e.g. for the features command the extension
/features?segment=ID
needs to be attached.
PROP optional, one or many a free key- value style property that allows to add more tags to a server

Example Responses




Retrieve the List of Entry Points for a Data Source (entry_points cmd)

This Entry_Points cmd is now mandatory for reference servers. Scope: Reference servers.

Command: entry_points

Format:


PREFIX/das/DSN/entry_points

Description: This query returns the list of sequence entry points available and their sizes in base pairs.

Arguments:

ref (deprecated)
If a sequence reference ID is provided in the ref argument, the query will return the components of the sequence (its subsequences) rather than the list of top-level entry point sequences. This argument is DEPRECATED, and superseded by the "component" category of the features request.
type (deprecated)
For ACEDB servers, the type parameter provides the class of the reference sequence, Sequence by default. DEPRECATED

Response:

The response to the entry_points command is the "DASEP" XML-formatted document:

Format:


<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
<DASEP>
  <ENTRY_POINTS href="url" version="X.XX">
    <SEGMENT id="id1" start="start1" stop="stop1" type="type" is now deprecated due to the registry should specify the type in this coordinate system  orientation="+">descriptive text</SEGMENT>

    <SEGMENT id="id2" start="start2" stop="stop2" type="type" orientation="+">descriptive text</SEGMENT>
    <SEGMENT id="id3" start="start3" stop="stop3" type="type" orientation="+">descriptive text</SEGMENT>

    ...
  </ENTRY_POINTS>
</DASEP>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the entry_points query, the doctype DTD is "http://www.biodas.org/dtd/dasep.dtd".
<DASEP> (required, one only)
The appropriate doctype and root tag is DASEP.
<ENTRY_POINTS> (The start and stop are now optional, only one)
There is a single <ENTRY_POINTS> tag. It has a version number (required) in the form "N.NN". Whenever the DNA of the entry point changes, the version number should change as well. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (optional; zero or more)
Each segment contains the attributes id, start, stop and orientation. The id is a unique identifier, which can be used as the reference ID in further requests to DAS. The start and stop indicate the start and stop positions of the segment. Orientation is one of "+" or "-" and indicates the strandedness of the segment (use "+" if the segment is not intrinsically ordered)The orientation is now optional.. If the optional subparts attribute is present and has the value "yes", it indicates that the segment has subparts.The subparts section is now deprecated? The type section is now deprecated as this should be specified by the registry.For compatibility with older versions of the specification, the <SEGMENT> tag can use a size attribute rather than start and stop, and can omit the orientation attribute:
      <SEGMENT id="id" size="123456">
       In this case, the start is implied to be "1" and the stop is implied to be the same as the length.

Note: The result from the entry points requests does not carry sufficient information to reconstruct a complex sequence assembly. Instead, use the features request with a category of "component". See [#assemblies Fetching Sequence Assemblies].


Retrieve the DNA Associated with a Subsequence has been deprecated as the sequence cmd below is more commonly used.


Retrieve the Sequence Associated with a Subsequence (sequence cmd)

Scope: Reference servers.

Command: sequence


Format:

<i>PREFIX</i>/das/<i>DSN</i>/sequence?segment=<i>RANGE</i>[;segment=<i>RANGE</i>...]


Description: This query returns the sequence (nucleotide or protein) corresponding to the indicated segment.


Arguments:

segment (required; one or more)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. If the start and stop positions are not provided, then the entire reference sequence is returned.

Here is an example of a valid request that uses the segment argument to fetch three independent segments. The last segment is a subsequence:

    http://www.wormbase.org/db/das/elegans/sequence?
        segment=BUM;segment=HUM_HGA;segment=CE_HOC2:1,200

The Sequence Response

The response to dna is the "DASSEQUENCE" XML-formatted document.


Format:

<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASSEQUENCE SYSTEM "http://www.biodas.org/dtd/dassequence.dtd">
<DASSEQUENCE>

  <SEQUENCE id="<i>id</i>" start="<i>start</i>" stop="<i>stop</i>"
               moltype="<i>moltype</i>" version="X.XX">
      atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
      taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
      agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa
      taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa
      aaatgagaaaaatcgacgaaaatcggtataaaatcaaataaaaatagaaggaaaatattc
      agctcgtaaacccacacgtgcggcacggtttcgtgggcggggcgtctctgccgggaaaat
      tttgcgtttaaaaactcacatataggcatccaatggattttcggattttaaaaattaata
      taaaatcagggaaatttttttaaattttttcacatcgatattcggtatcaggggcaaaat
      tagagtcagaaacatatatttccccacaaactctactccccctttaaacaaagcaaagag
      cgatactcattgcctgtagcctctatattatgccttatgggaatgcatttgattgtttcc
      gcatattgtttacaaccatttatacaacatgtgacgtagacgcactgggcggttgtaaaa
      cctgacagaaagaattggtcccgtcatctactttctgattttttggaaaatatgtacaat
      gtcgtccagtattctattccttctcggcgatttggccaagttattcaaacacgtataaat
      aaaaatcaataaagctaggaaaatattttcagccatcacaaagtttcgtcagccttgtta
      tgtcaaccactttttatacaaattatataaccagaaatactattaaataagtatttgtat
      gaaacaatgaacactattataacattttcagaaaatgtagtatttaagcgaaggtagtgc
      acatcaaggccgtcaaacggaaaaatttttgcaagaatca
  </SEQUENCE>
</DASDNA>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the sequence query, the doctype DTD is "http://www.biodas.org/dtd/dassequence.dtd".

<DASSEQUENCE> (required; one only)
The appropriate doctype and root tag is DASSEQUENCE. <p>
<SEQUENCE> (required; one or more)
There is a single <SEQUENCES> tag per requested segment. It has the attributes id, which indicates the reference ID for this sequence, start and stop, which indicate the position of this segment within the reference sequence, moltype, which indicates the molecular type of the sequence, and version, which provides the sequence map version number. All five attributes are required. <p> The molecule type is one of DNA, ssRNA, dsRNA, or Protein. No provision is made for circular molecules. <p> The content of this tag is the sequence itself, using standard IUPAC codes for DNA, RNA and protein. </dl> </td> </tr> </table>

Retrieve the Types Available for a Segment (types cmd)

Scope: Annotation and reference servers.

Command: types

Format:


PREFIX/das/DSN/types [?segment=RANGE]
                                   [;segment=RANGE]
                                   [;type=TYPE]
                                   [;type=TYPE]

Description: This query returns the annotation available for a segment of sequence.

Arguments:

segment (optional)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive.
type (optional)
One or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be used.

If one or more segment arguments are provided, the list of types returned is restricted to the indicated segments. If no segment argument is provided, then all feature types known to the source are returned.

Response:

The document returned from the types request is an XML-formatted "DASTYPES" documents. This is a shortened form of the full features format (see below) and is used to summarize the type and number of each annotation. Annotation types can be grouped into segments, or be totaled across the entire database.


<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASTYPES SYSTEM "http://www.biodas.org/dtd/dastypes.dtd">

<DASTYPES>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

     <TYPE id="id1" method="method" category="category">Type Count 1</TYPE>
     <TYPE id="id2" method="method" category="category">Type Count 2</TYPE>

     ...
  </SEGMENT>
  </GFF>
</DASTYPES>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the types query, the doctype DTD is "http://www.biodas.org/dtd/dastypes.dtd".
<DASTYPES> (required; one only)
The appropriate doctype and root tag is DASTYPES.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment. The id, start and stop attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The version attribute (required) indicates the current version of the sequence map. The optional label attribute supplies a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
<TYPE> (optional; zero or more per SEGMENT)
Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are id (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), method (optional), which indicates the method (subtype) for the feature type and the category (optional) attribute, which provides functional grouping to related types. The tag contents (optional) is a count of the number of features of this type across the segment.

Retrieve the Annotations Across a Segment (features cmd)

Scope: Reference and annotation servers.

Command: features

Format:


PREFIX/das/DSN/features?segment=REF:start,stop[;segment=REF:start,stop...]
                                      [;type=TYPE]
                                      [;type=TYPE]
                                      [;category=CATEGORY]
                                      [;category=CATEGORY]
                                      [;categorize=yes|no]
                                      [;feature_id=ID]

                                      [;group_id=ID]

Description: This query returns the annotations across one or more segments of sequence.

Arguments:

segment (zero or more)
If specified, the segment argument restricts the list of annotations to those that overlap the indicated range. Each segment argument uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. Multiple segments may be specified.
type (zero or more)
Zero or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on.
category (zero or more)
Zero or more category IDs to be used for filtering annotations by category. If multiple categories are provided, they are treated as the logical OR. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on.
categorize (optional)
Either "yes" or "no" (default). If "yes", then each annotation must include its functional category.
feature_id (zero or more; new in 1.5)
Instead of, or in addition to, segment arguments, you may provide one or more feature_id arguments, whose values are the identifiers of particular features. If the server supports this operation, it will translate the feature ID into the segment(s) that strictly enclose them and return the result in the features response. It is possible for the server to return multiple segments if the requested feature is present in multiple locations.
group_id (zero or more; new in 1.5)
The group_id argument, is similar to feature_id, but retrieves segments that contain the indicated feature group.

Annotation servers are only required to return annotations which are completely contained within the indicated segment. Servers may also return annotations which overlap the segment, but are not completely contained within them. Annotations must be returned using the coordinate system in which they were requested. For example, if a contig ID was used to specify the segment, then the annotation endpoints must use contig coordinates.

If multiple segment arguments are provided and they happen to overlap, then the annotation server may return the same annotation multiple times, possibly using different coordinate systems. It is the responsibility of the client to merge annotations based on the assembly.

Response:

The document returned from the features request is an XML-formatted "DASGFF" document.

Format:


<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASGFF SYSTEM "http://www.biodas.org/dtd/dasgff.dtd">
<DASGFF>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

      <FEATURE id="id" label="label">
         <TYPE id="id" category="category" reference="yes|no">type label</TYPE>

         <METHOD id="id"> method label </METHOD>
         <START> start </START>
         <END> end </END>

         <SCORE> [X.XX|-] </SCORE>
         <ORIENTATION> [0|-|+] </ORIENTATION>
         <PHASE> [0|1|2|-]</PHASE>

         <NOTE> note text </NOTE>
	 <LINK href="url"> link text </LINK>
	 <TARGET id="id" start="x" stop="y">target name</TARGET>

	 <GROUP id="id" label="label" type="type">
	       <NOTE> note text </NOTE>
	       <LINK href="url"> link text </LINK>

	       <TARGET id="id" start="x" stop="y">target name</TARGET>
         </GROUP>
      </FEATURE>
      ...
  </SEGMENT>
  </GFF>

</DASGFF>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the features query, the doctype DTD is "http://www.biodas.org/dtd/dasgff.dtd".
<DASGFF> (required; one only)
The appropriate doctype and root tag is DASGFF.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0 The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment coordinate system. The id, start and stop attributes indicate the position of the segment. The version attribute indicates the current version of the sequence map. The id, start, stop, and version attributes are required. The optional label attribute provides a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
<FEATURE> (optional; zero or more per SEGMENT)
There are zero or more <FEATURE> tags per <SEGMENT>, each providing information on one annotation. The id attribute (required) is a unique identifier for the feature. It can be used as a reference point for further navigation. The label attribute (optional) is a suggested label to display for the feature. If not present, the id attribute can be used instead.
<TYPE> (required; one per FEATURE)
Each feature has just one <TYPE> field, which indicates the type of the annotation. The attributes are id (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), and the category (optional, recommended) attribute, which provides functional grouping to related types. The reference server's annotations can consist of additional overlapping landmarks (parents, children, and neighbors), which should be marked "yes" in the third attribute reference (optional, defaults to "no") to indicate that the feature is a structural landmark within the map (this feature can be annotated). The tag contents (optional) is a human readable label for display purposes.If a reference annotation has either or both of the optional attributes, subparts="yes" and superparts="yes", then in addition to being useable as a reference sequence, the feature contains subparts and/or superparts that themselves can act as reference features. This can be used to reconstruct reference server's assembly. See also [#fetching_assembly Fetching Assembly Information].
<METHOD> (required; one per FEATURE)
Each feature has one <METHOD> field, which identifies the method used to identify the feature. The id (optional) tag can be used to retrieve further information from the annotation server. The tag contents (optional) is a human readable label.
<START>, <END> (required; one apiece per FEATURE)
These tags indicate the start and end of the feature in the coordinate system of the reference sequence given in the <SEGMENT> tag. The relationship between the feature start and stop positions and the segment start and stop is that the two spans are guaranteed to overlap.
<SCORE> (required; one per FEATURE)
This is a floating point number indicating the "score" of the method used to find the current feature. The number can only be understood in the context of information retrieved from the server by linking to the method. If this field is inapplicable, the contents of the tag can be replaced with a - symbol.
<ORIENTATION> (required; one per FEATURE)
This tag indicates the orientation of the feature relative to the direction of transcription. It may be for features that are unrelated to transcription, +, for features that are on the sense strand, and -, for features on the antisense strand.
<PHASE> (required; one per FEATURE)
This tag indicates the position of the feature relative to open reading frame, if any. It may be one of the integers , 1 or 2, corresponding to each of the three reading frames, or - if the feature is unrelated to a reading frame.
<NOTE> (optional; zero or more per FEATURE)
A human-readable note in plain text format.
<LINK> (optional; zero or more per FEATURE)
A link to a web page somewhere that provides more information about this feature. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per FEATURE)
The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. More information on the target can be retrieved by linking back to the annotation server. See [#feature_linking Linking to a Feature].
<GROUP> (optional; zero or more per FEATURE)
The <GROUP> section is slightly odd, as it is derived from an overloaded field in the GFF flat file format. It provides a unique "group" ID that indicates when certain features are related to each other. The canonical example is the CDS, exons and introns of a transcribed gene, which logically belong together. The group id attribute (required) provides an identifier that should be used by the client to group features together visually. Unlike other IDs in this protocol, the group ID cannot be used as a database handle to retrieve further information about the group. Such information can, however, be provided within <GROUP> section, which may contain up to three optional tags.The label attribute (optional) provides a human-readable string that can be used in graphical representations to label the glyph.The type attribute (optional) provides a type ID for the group as a whole, for example "transcript". This ID can be used as a key into the [#stylesheet stylesheet] to select the glyph and graphical characteristics for the group as a whole.
<NOTE> (optional; zero or more per GROUP)
A human-readable note in plain text format.
<LINK> (optional; zero or more per GROUP)
A link to a web page somewhere that provides more information about this group. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per GROUP)
The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. NOTE: although this tag is present in the GROUP section, it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE> section. Earlier versions of this specification placed the TARGET tag in the GROUP section, and clients must recognize and accomodate this.
New in version 1.5: Exception Handling for Invalid Segments

The request for a named segment may fail because: (1) the reference sequence is not known to the server or (2) the requested region is outside the bounds of the segment. In both cases, an exception is indicated. In the case of a reference server, which is expected to be authoritative for the map, the <GFF> section will flag the problem by issuing an <ERRORSEGMENT> tag instead of the usual <SEGMENT> tag. This tag has the following format: <ERRORSEGMENT id="id" start="start" stop="stop">The id attribute (required) corresponds to the ID of the requested segment, and start and stop (optional) correspond to the requested bounds of the segment if this was specified in the request.Unlike a reference server, an annotation server is not required to know the identities of all the segments. Therefore when presented with a segment ID that it doesn't recognize, it can't know whether this is a true client error or merely an unannotated segment. In this case, an annotation server will issue an <UNKNOWNSEGMENT> tag. This tag has the same syntax as <ERRORSEGMENT> but doesn't necessarily imply an error.If an annotation server detects a request for a region outside the bounds of a segment that it has annotated, it will issue an <ERRORSEGMENT> exception.In the case of a request for multiple segments, the server will return a mixture of <SEGMENT> sections for valid segments, and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for invalid ones.


Examples

<DASGFF>

 <GFF version="1.01" href="http://das.sanger.ac.uk:80/das/pfam/features">

<SEGMENT id="P08487" version="d1dfb367c112d4820eeffe4eab1d6487" start="1" stop="1291"><FEATURE id="C2" label="C2:1090-1177"><TYPE id="SO:0000417" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_domain</TYPE><START>1090</START><END>1177</END><METHOD id="Pfam">Pfam-A</METHOD><SCORE>1.7e-18</SCORE><NOTE>HMMER Version: 2.3.2</NOTE><LINK href="http://pfam.sanger.ac.uk/family?entry=PF00168">C2</LINK></FEATURE><FEATURE id="PI-PLC-X" label="PI-PLC-X:322-465"><TYPE id="SO:0100021" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_conserved_region</TYPE><START>322</START><END>465</END><METHOD id="Pfam">Pfam-A</METHOD><SCORE>7.2e-93</SCORE><NOTE>HMMER Version: 2.3.2</NOTE><LINK href="http://pfam.sanger.ac.uk/family?entry=PF00388">PI-PLC-X</LINK></FEATURE></SEGMENT> </GFF>

</DASGFF>


We are proposing to remove Linking to a Feature from the spec

Scope: Annotation servers.

Command: link

Format:


PREFIX/das/DSN/link?field=TAG;id=ID

Description: This query can be issued in order to retrieve further human-readable information about an annotation. It is best to pass this URL directly to a browser, as the type of the returned data is not specified (it will typically be an HTML file, but any MIME format is allowed).

Arguments:

field (required)
The field to fetch further information on. Options are:
  • feature -- the feature itself
  • type -- the feature type
  • method -- the feature method
  • category -- the feature category
  • target -- the target, applicable to sequence similarities only
id (required)
The ID of the indicated annotation field.

Response: A web page.


Retrieving the Stylesheet

Scope: Annotation servers.

Command: stylesheet

Format:


PREFIX/das/DSN/stylesheet

Description: This query can be issued to an annotation server in order to retrieve the server's recommendations on formatting annotations retrieved from it. These recommendations are not normative. A viewer is free to use any display format it chooses.

Arguments: None.

Response:

This document is intended to provide hints to the annotation display client. It maps feature categories and individual types to a series of glyphs known to the display client.

Format:


<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASSTYLE SYSTEM "http://www.biodas.org/dtd/dasstyle.dtd">
<DASSTYLE>
  <STYLESHEET version="X.XX">

     <CATEGORY id="default">
         <TYPE id="default">
	   <GLYPH zoom="high">

             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	   <GLYPH zoom="medium">
             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
	   <GLYPH zoom="low">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
     </CATEGORY>

     <CATEGORY id="group">
         <TYPE id="group_id1">
	   <GLYPH zoom="high">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
           ...
     </CATEGORY>


     <CATEGORY id="category1">
         <TYPE id="default">
	   <GLYPH>
             <ID>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         <TYPE id="type1">

	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>

         </TYPE>
         <TYPE id="type2">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         ...
     </CATEGORY>

     <CATEGORY id="category2">

         <TYPE id="default">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	</TYPE>
         ...
     </CATEGORY>
     ...

</STYLESHEET>
</DASSTYLE>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the stylesheet query, the doctype DTD is "http://www.biodas.org/dtd/dasstyle.dtd".
<DASSTYLE> (required; one only)
The appropriate doctype and root tag is DASSTYLE.
<STYLESHEET> (required; one only)
There is a single <STYLESHEET> tag. Its version (required) attribute indicates the current version of the stylesheet, and can be used for caching purposes.
<CATEGORY> (required; one or more)
There are one or more <CATEGORY> tags, each providing information on the display of a high-level feature category. The id (required) tag uniquely names the category. A special name is "default", which tells the annotation viewer what format to use for categories that are not otherwise specified in the stylesheet. Another special name is "group". A "group" entry indicates the format to use for a particular group of features.
<TYPE> (required; one or more per CATEGORY)
There are one or more <TYPE> tags per <CATEGORY>, each providing display suggestions for one type of annotation. The id (required) uniquely identifies the type. A special id is "default", which, if present, identifies a default style for the enclosing category.
<GLYPH> (required; one or more per TYPE)
There is one or more <GLYPH> tag per <TYPE>. It provides information on what glyph (graphical widget) to use to display the indicated annotation type. The optional zoom attribute, implements a simple form of semantic zooming, and allows the client to select the glyph and its attributes based on the zoom level. Possible values are "high", "medium" and "low". If multiple <GLYPH> tags are present, this attribute must be present in order to select among them. A "high" zoom means that there are fewer base pairs per pixel (high magnification). A "low" zoom shows more base pairs. "Medium" is intermediate. It is left to the client to determine the boundaries for "high", "medium" and "low", since this is a function of the graphics rendering.
<ID> (required; one per GLYPH)
The ID value refers to a recognized glyph from the glyph types list ([#glyphid see below]).
<ATTR> (optional; one or more per ID)
The recognized ATTR (attributes) are determined by which glyph ID is specified. See the [#glyphid glyph types] list below for more information.

Here is a short stylesheet example:


			...
     <CATEGORY id="Similarity">
	<TYPE id="default">
	     <GLYPH>

                  <LINE>
		       <FGCOLOR>gray</FGCOLOR>
                  </LINE>
	     </GLYPH>
	</TYPE>

	<TYPE id="NN">
	     <GLYPH >
                  <BOX>
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>	
		       <BGCOLOR>red</BGCOLOR>

                  </BOX>
	     </GLYPH>
	</TYPE>
	<TYPE id="NP">
	     <GLYPH>
                  <TOOMANY>

		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>
		       <BGCOLOR>blue</BGCOLOR>
                  </TOOMANY>

	     </GLYPH>
	</TYPE>
	<TYPE id="PN">
	     <GLYPH>
                  <BOX>
		       <HEIGHT>3</HEIGHT>

		       <FGCOLOR>blue</FGCOLOR>
		       <BGCOLOR>green</BGCOLOR>
                  </BOX>
	     </GLYPH>
	</TYPE>

	<TYPE id="PP">
	     <GLYPH>
                  
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>gray</FGCOLOR>

                  
	     </GLYPH>
	</TYPE>
     </CATEGORY>
      ...

Groups can also have stylesheet entries. If present, they are located in the category named "group". Typically a group will be associated with the "line" glyph, which as described below, draws connections between the members of a group.

A sample stylesheet used for the WormBase DAS server can be found at [sample_stylesheet.xml http://www.biodas.org/documents/sample_stylesheet.xml].

Glyphs and Groups

Glyphs and their attributes are typically applied to individual features. However, they can be applied to entire groups as well (via the <GROUP> type attribute). In this case, the glyph will apply to the connecting regions between the components of the group.

For example, to indicate that the exons in a "transcript" group should be drawn with a yellow box, that the utrs should be drawn with a blue box, and that the connections between exons should be drawn with a hat-shaped line:


<CATEGORY id="Transcription">
   <TYPE id="exon">
      <GLYPH>
         <BOX>
            <BGCOLOR>yellow</BGCOLOR>

         </BOX>
      </GLYPH>
   </TYPE>

   <TYPE id="utr">
      <GLYPH>
         <BOX>

            <BGCOLOR>blue</BGCOLOR>
         </BOX>
      </GLYPH>
   </TYPE>
</CATEGORY>

<CATEGORY id="group">
<TYPE id="transcript">
   <GLYPH>
      <LINE>
         <FGCOLOR>black</FGCOLOR>
         <LINE_STYLE>hat</LINE_STYLE>

      </LINE>
   </GLYPH>
</TYPE>
...

Fetching Sequence Assemblies We are proposing to deprecate this as not many people use it????

Reference servers, but not annotation servers, must represent and serve genome assemblies.

The components of an assembly are treated as a set of features with a type category attribute of "component" and a reference attribute of "yes". Intermediate components of the assembly will also have a subparts attribute of "yes". Components that are the parents of the reference sequence in the assembly have a category attribute of "supercomponent."

Moving Down in an Assembly

For those components that have subparts, the start and end of the feature give the feature's position in the requested segment's coordinate system, and the id, start and end of the <TARGET> element gives the feature's position in its native coordinates.

For example:


         1      200         400                1000
         +--------+-----------+-------------------+ chr22

         1      200 220     1 20                620
         +--------+---- A   --+-------------------+ B

            1    80         280     400
            ------+-----------+-------- C

            =================== C.1
                          ============= C.2

A request for this assembly will look like the following:


http://www.wormbase.org/db/das/elegans/features?segment=chr22:1,1000;category=component

The reference server will return the following (abbreviated) document:


<SEGMENT id="chr22" start="1" stop="1000">

  <FEATURE id="chr22">
    <START>1</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="no" subparts="yes">chr 22</TYPE>

    <TARGET id="chr22" start="1" stop="1000">chr22</TARGET>
    ...
  </FEATURE>

<FEATURE id="Contig:A">
    <START>1</START>

    <STOP>200</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>
    <TARGET id="A" start="1" stop="200">Contig A</TARGET>
    ...
  </FEATURE>

  <FEATURE id="Contig:B">
    <START>400</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>

    <TARGET id="B" start="20" stop="620">Contig B</TARGET>
    ...
  </FEATURE>


  <FEATURE id="Contig:C">
    <START>200</START>

    <STOP>400</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
    <TARGET id="C" start="80" stop="280">Contig C</TARGET>    ...
  </FEATURE>

</SEGMENT>

Notice that contig C is marked as having subparts. This is an indication to the client that it should emit a features request that includes segment C:80,280 in order to discover its components (C.1 and C.2).

Notice also that chr22 appears as a component of itself with the attribute superparts="no" and subparts="yes". This is a side effect of providing information about the component parent.

Moving Up in an Assembly

It is also desirable for a client to fetch the parent of a segment, so as to accomodate the situation in which the user enters the browser at a contig or sequenced clone, and wants to "zoom out."

This situation is complicated by rough draft issues, in which a single rough draft sequence segment may have multiple parents, and some sections of the segment may not belong in the assembly at all. For example:


                        A   B     C   D
           contig21----------->  <-----------contig100

                        |   |    /   /
                        |   |   /   /
             Acc  A ---------------------
                        a   b  c   d

Here, the segment "Acc A" contains two fragments, one of which is located on contig21 and the other on contig100.

To retrieve this information, the client requests the category supercomponent. For segments that are in the middle of the assembly, one or more assembly parents will be returned in addition to subcomponents. The parent <START>, <STOP> and <ORIENTATION> tags are presented in the coordinate system of the requested segment, as always. The start and stop attributes of the <TARGET> tag, denote the corresponding segment in the coordinate system of the parent. As always, start is less than stop, for both the feature and the target.


<SEGMENT id="Acc A" start="1" stop="1000">
   <FEATURE id="contig21_goldenpath_map">
      <START>a</START>
      <STOP>b</STOP>

      <ORIENTATION>+</ORIENTATION>
      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig21" start="A" stop="B"></TARGET>
   </FEATURE>

   <FEATURE id="contig100_goldenpath_map">
      <START>c</START>
      <STOP>d</STOP>
      <ORIENTATION>-</ORIENTATION>

      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig100" start="D" stop="C"></TARGET>
   </FEATURE>
</SEGMENT>

To continue following the parents upward in the assembly, the client will issue further features requests for the target IDs, in this case "contig21" and "contig100". In the general case, following parents will project the requested segment onto a discontinuous set of regions, potentially on different chromosomes. The client may wish to alert the user and refuse to proceed further when it encounters a segment with multiple parents.


Feature Types and Categories

This is a list of generic feature categories and specific feature types within them. This list was derived from the features currently exported by ACeDB/GFF and is not comprehensive. Suggestions for modifications, additions and deletions are welcomed.

component

This category indicates that the feature is a child component of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve subfeatures contained within it (including subcomponents).

supercomponent

This category indicates that the feature is the parent of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve features that completely contain the selected range of the reference sequence.

translation

The translation category is used for features that relate to regions of the sequence that are translated into proteins. Features that relate to transcription are separate (see below).

Features:

  • stop - position of the translation stop codon
  • ATG - position of the start codon
  • CDS - position of the coding region
  • 5'UTR - untranslated region
  • 3'UTR - untranslated region
  • misc_translated - miscellaneous

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

transcription

The transcription category is used for features that relate to regions of the sequence that are transcribed into RNA.

Features:

  • exon
  • intron
  • tRNA
  • mRNA
  • ncRNA
  • 5'Cap - transcriptional start site
  • PolyA
  • Splice5 - splice donor
  • Splice3 - splice acceptor
  • misc_transcribed

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

variation

The variation category is used for features that relate to regions of the sequence that are polymorphic.

Features:

  • insertion
  • deletion
  • substitution
  • misc_variation

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the variation.

structural

The structural category is used for features that relate to mapping, sequencing and assembly, as well as for various landmarks that carry no intrinsic biological information.

Features:

  • clone
  • primer_left
  • primer_right
  • oligo
  • assembly_tag
  • misc_structural

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the structural feature.

similarity

The similarity category is used for areas that are similar to other sequences. Similarity features should have a <METHOD> tag that indicates the algorithm used for the sequence comparison, and a <TARGET> tag that indicates the target of the match.

Features:

  • NN -- nucleotide to nucleotide similarity (e.g. blastn)
  • NP -- nucleotide to protein similarity (e.g. blastx)
  • PN -- protein to nucleotide similarity (e.g. tblastn)
  • PP -- protein to protein similarity (e.g. tblastx)
  • misc_homology

repeat

The repeat category is used for areas that contain repetitive DNA. This category is used both for low-complexity regions, such as microsatellites, and for more biologically interesting features, such as transposon insertion sites.

Features:

  • microsatellite
  • inverted
  • tandem
  • transposable_element
  • LINE - long repeat not definitely identified as a transposon
  • misc_repeat

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the repetitive element.

experimental

The experimental category is a catchall used to flag areas where there is interesting experimental data of one sort or another. It is intended for use with high-throughput functional genomics work, such as knockouts or insertional mutagenesis screens.

Features:

  • knockout
  • expression_tag
  • microarrayed
  • RNAi_result
  • transgenic
  • mutant - a mutant phenotype associated with region
  • misc_experimental

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the nature of the experimental data.


Glyph Types

This section describes a set of generic "glyphs" that can be used by sequence display programs to display the position of features on a sequence map. The annotation server may use these glyphs to send display suggestions to the viewer via the [#stylesheet stylesheet document].

The current set of glyph ID values are:

  • ARROW
  • ANCHORED_ARROW
  • BOX
  • CROSS
  • EX
  • HIDDEN
  • LINE
  • SPAN
  • TEXT
  • TOOMANY
  • TRIANGLE
  • PRIMERS

Each glyph has a set of attributes associated with it. Attribute values come in the following flavors:

INT
An integer
FLOAT
A floating point number (not currently used)
STRING
A text string
COLOR
A color. Colors can be specified using the "#RRGGBB" format commonly used in HTML, or as one of the 16 IBM VGA colors recognized by Netscape and Internet Explorer.
BOOL
A boolean value, either "yes" or "no".
FONT
A font. Any of the font identifiers recognized by Web browsers is acceptable, e.g. "helvetica".
FONT_STYLE
One of "bold", "italic", "underline".
LINE_STYLE
One of "hat", "solid", "dashed".

Some attributes are shared by all glyphs. Others are glyph-specific. The following attributes are shared in common:

HEIGHT
type: INT
The height of the glyph, in pixels. For the text font, this is equivalent to the FONTSIZE attribute.
FGCOLOR
type: COLOR
The foreground color of the glyph. This is the line and outline color for graphical glyphs, and the font color for text glyphs.
BGCOLOR
type: COLOR
The background color of the glyph. For hollow glyphs, such as boxes, this is the color of the interior of the box. For solid glyphs, such as text, this is ignored
LABEL
BOOL
Whether the glyph should be labeled with its name, as dictated by the <FEATURE> label attribute in the DASGFF document.
BUMP
BOOL
Whether the glyph should "bump" intersecting glyphs so that they do not overlap.

ARROW

A double-headed arrow with an axis either orthogonal or parallel to the sequence map.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

ANCHORED_ARROW

An arrow that has an arrowhead at one end, and an "anchor" (typically a diamond or line) at the other. The arrow points in the direction indicated by the <ORIENTATION> tag.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

BOX

A rectangular box.

Attributes:

LINEWIDTH
type: INT
Width of the box outline.

CROSS

A cross "+". Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

DOT

A dot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

EX

"X" marks the spot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

HIDDEN

A feature that is invisible, intended to support semantic zooming schemes in which a feature is hidden at particular zooms.

Attributes: none.

LINE

A line. Lines are equivalent to arrows with both the northeast and southwest attributes set to "no".

Attributes:

STYLE
type: LINE_STYLE
The line type. A type of "hat" draws an inverted V (commonly used for introns). A type of "solid" draws a horizontal solid line in the indicated color. A type of "dashed" draws a dashed horizonal line in the indicated color.

SPAN

A spanning region, the recommended representation is a horizontal line with vertical lines at each end.

Attributes:

(no glyph-specific attributes)

TEXT

A bit of text.

Attributes:

FONT
type: FONT
The font.
FONTSIZE
type: INT
The font size.
STRING
type: STRING
The text to render.
STYLE
type: FONT_SYTLE
The style in which to render this glyph. Multiple FONT_STYLE attributes may be present.

PRIMERS

Two inward-pointing arrows connected by a line of a different color. Used for showing primer pairs and a PCR product. The length of the arrows is meaningless.

There are no glyph-specific attributes, but in this context the foreground color is the color of the arrows, and the background color is the color of the line that connects them.

TOOMANY

Too many features than can be shown. Recommended for use in consolidating sequence homology hits. The recommended visual presentation is a set of overlapping boxes.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.

TRIANGLE

A triangle. Commonly used for point mutations and other point-like features. The triangle is always drawn in the center of its range, but its width and height can be controlled by HEIGHT and LINEWIDTH respectively.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.
DIRECTION
One of "N", "E", "S", and "W"

Other Issues

The distributed annotation system must have a mechanism for detecting and resolving version skew across reference and annotation servers. Although one such mechanism is currently incorporated into the ACeDB-based prototype, it is largely untested and hence not yet a part of the DAS standard.

Changes

Last modified: 08 Oct 2008