|
|
| (3 intermediate revisions by one other user not shown) |
| Line 1: |
Line 1: |
| − | <h1 align=CENTER><font color="red">Distributed Sequence Annotation
| + | #REDIRECT [[Spec Review]] |
| − | System (DAS) Spec Review</font></h1>
| |
| − | <h3 align=CENTER>Version 2.53</h3>
| |
| − | | |
| − | <h5 align=CENTER>Oct 1,2008</h5>
| |
| − | | |
| − | <p> This is a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the <a href="http://www.dasregistry.org/spec_1.53E.jsp">1.53E spec</a> and some of the 2.0 spec.
| |
| − | Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as alignments and protein. The spec also includes references to the DAS Registry which is essential for
| |
| − | implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures.
| |
| − | <p style="background-color: #DEB887">
| |
| − | | |
| − | Proposed modifications to the spec are
| |
| − | indicated in brown.
| |
| − | | |
| − | | |
| − | <h2><a name="description">Overview of the System</a></h2>
| |
| − | This section provides a high-level view of the system architecture.
| |
| − | | |
| − | | |
| − | <h3><a name="components">System Components (Co-ordinate System Servers, Annotation Servers and the DAS Registry)</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The DAS system consists of the a reference server, one or more
| |
| − | annotation servers and the das registry.
| |
| − | | |
| − | </p>
| |
| − | <h4><a name="referenceServer">Reference Server</a></h4>
| |
| − | Central to the DAS system is the idea of reference objects that can be served from a reference server.
| |
| − | These are biological data objects with stable identifiers which are targets for annotation.
| |
| − | In the original DAS protocol, the reference objects are always biological sequences: chromosomes, scaffold sequences from genome assemblies or protein sequences.
| |
| − | When a DAS client starts, its first action is to connect to an appropriate reference server and retrieve the reference sequence.
| |
| − | Once a reference object has been loaded, the DAS client will contact one or more annotation servers to obtain the data provided for the reference objects.
| |
| − | Typical annotations might include sets of predicted exons on a genome sequence, or matches to a protein domain model on a protein sequence.
| |
| − | It is the client's responsibility to collect all relevant annotations and display them in a user-friendly manner.
| |
| − | <p> A coordinate system describes the data that is made available by a DAS source/reference server. This information is important for the DAS clients, to deal with data correctly, as they often can accept data served in multiple coordinate systems.
| |
| − | The coordinate systems are described by four fields: Authority, (assembly) Version, Type, and Organism. The assembly version is important for genome assemblies, but not really applicable for other datasets like UniProt sequences, therefore this field is optional.
| |
| − | </p>
| |
| − | <h4><a name="annotationServer">Annotation Server</a></h4>
| |
| − | | |
| − | Annotation servers are specialized for returning lists of annotations
| |
| − | across a reference object served by the reference server. Each annotation can be anchored to
| |
| − | the co-ordinate system map by way of a start and stop position relative to one of
| |
| − | the reference objects.
| |
| − | Annotations have an ID that is unique to
| |
| − | the server and a structured description that describes its nature and
| |
| − | attributes. Annotations may also be associated with Web URLs that
| |
| − | provide additional human readable information about the annotation.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Annotations have <i>types</i>, <i>methods</i> and <i>categories</i>.
| |
| − | The annotation <b>type</b> is selected from a list of types that have
| |
| − | biological significance <font color="red"> though these do not help the readability of xml returned so I can see why people are reluctant to adapt them</font>),
| |
| − | <font color="red">delete this EMBL bit?</font> and correspond roughly to EMBL/GenBank
| |
| − | feature table tags. Examples of annotation types include "exon",
| |
| − | "intron", "CDS" and "splice3."(We encourage the use of the <a href="http://www.sequenceontology.org/">Sequence Ontology</a>
| |
| − | <font color="blue">Tip: We recommend OboEdit for looking up ontologies for regular use and the ontologies it uses can be downloaded from <a href="http://www.berkeleybop.org/ontologies/#ontologies">here</a></font>
| |
| − | IDs to give uniformity to DAS sources for example CDS is SO:0000316 <font color="red"> is there a better resource out there that you can go from id to name and desciption and visa versa??</font>). The annotation <b>method</b> is
| |
| − | intended to describe how the annotated feature was discovered, and may
| |
| − | include a reference to a software program (we also encourage the use of ECO numbers to represent the method of annotation e.g.ECO:0000032 "inferred from curated blast match to nucleic acid). The annotation
| |
| − | | |
| − | <a href="http://www.ebi.ac.uk/ontology-lookup/">
| |
| − | | |
| − | | |
| − | <b>category</b> is a broad functional category that can be used to
| |
| − | filter, group and sort annotations. "Homology", "variation" and
| |
| − | "transcribed" are all valid categories. The existence of these
| |
| − | categories allows researchers to add new annotation types if the
| |
| − | existing list is inadequate without entirely losing all semantic
| |
| − | value. The <a href="#categories">Annotation Categories</a> section
| |
| − | contains a list of the annotation types in use in the
| |
| − | <cite>C. elegans</cite> project.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is intended that larger annotation servers provide pointers to
| |
| − | human-readable data that describes its types, methods and categories
| |
| − | in more detail. Another optional feature of annotation servers is the
| |
| − | ability to provide hints to clients on how the annotations should be
| |
| − | rendered visually. This is done by returning a XML "stylesheet".
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The co-ordinate system server is an annotation server that provides
| |
| − | the following additional services:
| |
| − | | |
| − | <ol>
| |
| − | <li>Given a reference sequence id, it can return the raw DNA of that sequence.
| |
| − | <li>Given a reference sequence id, it can return annotations of the
| |
| − | category "component". Component annotations describe how the
| |
| − | sequence is assembled from smaller parts into large parts from the
| |
| − | top down.
| |
| − | <li><font color="red">deprecate this?</font>Given a reference sequence id, it can return annotations of the
| |
| − | category "supercomponent". Component parent annotations
| |
| − | describe the assembly of the sequence from the bottom up.
| |
| − | | |
| − | </ol>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Although the servers are conceptually divided between reference
| |
| − | servers and annotation servers, there is in fact no key difference
| |
| − | between them. A single server can provide both reference sequence
| |
| − | information and annotation information. The main functional
| |
| − | difference is that the reference sequence server is required to serve
| |
| − | the sequence map and the raw DNA, while annotation servers have no
| |
| − | such requirement <font color="red">how to generalise this? What does not serve sequence info?</font>.
| |
| − | | |
| − | <p>
| |
| − | <h4><a name="dasRegistry">The DAS Registry</a></h4>
| |
| − | central DAS registry which implements this protocol and fulfils the following roles:
| |
| − | | |
| − | 1. It allows discovery of available DAS sources via a web page, or as machine-readable XML which can be used directly by DAS client programs.
| |
| − | | |
| − | 2. It automatically validates registered DAS sources to ensure that they return well formed DAS XML.
| |
| − | | |
| − | 3. It periodically tests DAS sources and notifies their administrators if they are unavailable.
| |
| − | | |
| − | 4. It can group the registered DAS sources according to the coordinate systems of their data.
| |
| − | | |
| − | 5. It can also communicate bi-directionally with DAS clients and activate or highlight DAS sources in clients.
| |
| − | </p>
| |
| − | | |
| − | | |
| − | <h2><a name="client_server">Client/Server Interactions</a></h2>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The DAS is Web-based. Clients query the reference and annotation
| |
| − | servers by sending a formatted URL request to the server. This
| |
| − | request must follow the conventions of the HTTP/1.0 protocol (see <a
| |
| − | href="ftp://ftp.isi.edu/in-notes/rfc2616.txt">RFC2616</a>. Servers
| |
| − | process the request and return a response in the form of a formatted
| |
| − | XML document (see <a href="http://www.w3.org/XML/">W3C Extensible
| |
| − | Markup Language</a>).
| |
| − | | |
| − | <h3><a name="request">The Request</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | All DAS requests take the form of a URL. Each URL has a site-specific
| |
| − | prefix, followed by a standardized path and query string. The
| |
| − | standardized path begins with the string <b>/das</b>. This is
| |
| − | followed by URL components containing the data source name and a
| |
| − | command. For example:
| |
| − | | |
| − | <blockquote><pre>
| |
| − | http://www.wormbase.org/db/das/elegans/features?segment=CHROMOSOME_I:1000,2000
| |
| − | ^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
| |
| − | site-specific prefix das data command arguments
| |
| − | src
| |
| − | </pre></blockquote>
| |
| − | <font color="red">give some more examples here</font>
| |
| − | In this case, the site-specific prefix is
| |
| − | <b>http://www.wormbase.org/db</b>. The request begins with the
| |
| − | standardized path <b>/das</b>, and the data source, in this case
| |
| − | <b>/elegans</b>. This is followed by the command <b>/features</b>,
| |
| − | which requests a list of features, and a query string providing named
| |
| − | arguments to the <b>/features</b> command.
| |
| − | | |
| − | | |
| − | <p>
| |
| − | | |
| − | The data source component allows a single server to provide
| |
| − | information on several genomes.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | More information on the format of the request and the various
| |
| − | available commands is given <a href="#commands">below</a>.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The query string portion of the request (the "?" symbol rightward) can
| |
| − | be POSTed to the URL following conventional HTTP standards. Since
| |
| − | some queries can be quite large, this is the recommended way of
| |
| − | argument passing.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <h3><a name="response">The Response</a></h3>
| |
| − | | |
| − | The response from the server to the client consists of a
| |
| − | standard HTTP header with DAS status information
| |
| − | within that header followed optionally by an XML file that contains
| |
| − | the answer to the query. The DAS status portion of the header consists
| |
| − | of two lines. The first is X-DAS-Version and gives the current
| |
| − | protocol version number, currently DAS/1.0. The second line
| |
| − | is X-DAS-Status and contains a three digit status code which
| |
| − | indicates the outcome of the request.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Here is an example HTTP header: (<i>provided by Web server</i>)
| |
| − | | |
| − | <blockquote><pre>
| |
| − | HTTP/1.1 200 OK
| |
| − | Date: Sun, 12 Mar 2000 16:13:51 GMT
| |
| − | Server: Apache/1.3.6 (Unix) mod_perl/1.19
| |
| − | Last-Modified: Fri, 18 Feb 2000 20:57:52 GMT
| |
| − | Connection: close
| |
| − | Content-Type: text/plain
| |
| − | X-DAS-Version: DAS/1.5
| |
| − | X-DAS-Status: 200
| |
| − | X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
| |
| − | <cite>data follows...</cite>
| |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The defined status codes are listed in Table 1.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <table border>
| |
| − | <caption>Table 1: DAS response codes</caption>
| |
| − | <tr><th>200</th> <td>OK, data follows</td></tr>
| |
| − | <tr><th>400</th> <td>Bad command (command not recognized)</td></tr>
| |
| − | <tr><th>401</th> <td>Bad data source (data source unknown)</td></tr>
| |
| − | | |
| − | <tr><th>402</th> <td>Bad command arguments (arguments invalid)</td></tr>
| |
| − | <tr><th>403</th> <td>Bad reference object (reference sequence unknown)</td></tr>
| |
| − | <tr><th>404</th> <td>Bad stylesheet (requested stylesheet unknown)</td></tr>
| |
| − | <tr><th>405</th> <td>Coordinate error (sequence coordinate is out
| |
| − | of bounds/invalid)</td></tr>
| |
| − | | |
| − | <tr><th>500</th> <td>Server error, not otherwise specified</td></tr>
| |
| − | <tr><th>501</th> <td>Unimplemented feature</td></tr>
| |
| − | </table>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The HTTP/1.0 protocol allows web clients to request byte-level
| |
| − | compression of the response by sending the HTTP header
| |
| − | <i>Accept-Encoding</i> header. Web servers that are capable of it can
| |
| − | reply with a <i>Content-transfer-encoding</i> header and a compressed
| |
| − | body. Implementors of DAS clients and servers may wish to implement
| |
| − | this HTTP feature.
| |
| − | | |
| − | | |
| − | <p>
| |
| − | | |
| − | <table bgcolor="#DEB887" border="1">
| |
| − | <tr><th>New in version 1.5</th></tr>
| |
| − | <tr><td>
| |
| − | The X-Das-Capabilities header provides an extensible list of the
| |
| − | capabilities that the server provides. This can be used by those
| |
| − | writing experimental extensions to DAS to flag clients that those
| |
| − | extensions are available. Capabilities have the form
| |
| − | <i>CapabilityName/Version</i> and are separated by semicolon,
| |
| − | space, as in "capabilityA/1.0; capabilityB/1.4;
| |
| − | capabilityC/1.0". The following standard capabilities
| |
| − | are present in the DAS/1.5 protocol:
| |
| − | <table border="1">
| |
| − | <tr>
| |
| − | <th>Capability Name</th><td>Description</td>
| |
| − | | |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">dsn/1.0</th>
| |
| − | <td>The server supports the basic <i>dsn</i> request.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">dna/1.0</th>
| |
| − | | |
| − | <td>The server supports the basic <i>dna</i> request.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">types/1.0</th>
| |
| − | <td>The server supports the basic <i>types</i> request.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">stylesheet/1.0</th>
| |
| − | <td>The server supports the basic <i>stylesheet</i> request.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">features/1.0</th>
| |
| − | <td>The server supports the basic <i>features</i> request.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">entry_points/1.0</th>
| |
| − | <td>The server supports the basic <i>entry_points</i> request.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">error-segment/1.0</th>
| |
| − | <td>Server will report requests for invalid segments with an
| |
| − | <ErrorSegment> response.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">unknown-segment/1.0</th>
| |
| − | <td>Server will report requests for unknown or unannotated segments with an
| |
| − | <UnknownSegment> response.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">unknown-feature/1.0</th>
| |
| − | <td>Server will report requests for unknown features with an
| |
| − | <UnknownFeature> response.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">feature-by-id/1.0</th>
| |
| − | <td>The <i>features</i> request will accept the CGI parameter "feature_id", enabling
| |
| − | the server to look up segment(s) based on the ID of a feature.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">group-by-id/1.0</th>
| |
| − | <td>The <i>features</i> request will accept the CGI parameter "group_id", enabling
| |
| − | the server to look up segment(s) based on the ID of a group.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">component/1.0</th>
| |
| − | <td>The <i>features</i> request will return components of the indicated segment when
| |
| − | a category type of "component" is requested.
| |
| − | </tr>
| |
| − | <tr>
| |
| − | <th align="LEFT">supercomponent/1.0</th>
| |
| − | <td>The <i>features</i> request will return supercomponents of the indicated segment when
| |
| − | a category type of "supercomponent" is requested.
| |
| − | </tr>
| |
| − | | |
| − | <tr>
| |
| − | <th align="LEFT">sequence/1.0</th>
| |
| − | <td>The server supports the new <i>sequence</i> request.
| |
| − | </tr>
| |
| − | </table>
| |
| − | </td></tr>
| |
| − | </table>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | | |
| − | | |
| − | <h3><a name="co-ordinateSystem">The Co-ordinate System</a></h3>
| |
| − | | |
| − | The distributed annotation system (DAS) relies on there being a common
| |
| − | "co-ordinate system" on which to base annotations. The co-ordinate system consists of a set of "entry points", and
| |
| − | the lengths of each entry point <font color="red">but not all in the case of alignments??</font>. The identity of an entry point will
| |
| − | vary from co-ordinate system to co-ordinate system. For some projects, entry points
| |
| − | correspond to entire chromosomes. For others, entry points may be a
| |
| − | series of contigs or proteins.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The entry points describe the top level items on the co-ordinate system.
| |
| − | <font color="red">remove this section on subsequence?</font>It is possible for each entry point to have substructure, basically
| |
| − | a series of subsequences (components) and their start and end points. This
| |
| − | structure is recursive. Each annotation is unambiguously located by providing
| |
| − | its position as the start and stop positions relative to a "reference object."
| |
| − | The reference object can be one of the entry points, or any of the
| |
| − | subsequences within the entry point.<br/>
| |
| − | | |
| − | | |
| − | To give a concrete example, the <cite>C. elegans</cite> reference map
| |
| − | consists of six chromosome-length entry points. Each chromosome is
| |
| − | formed from several contigs called "superlinks", and each superlink
| |
| − | contains one or more smaller contigs called "links". Links in turn
| |
| − | are composed of one or more fully-sequenced clones. One could refer
| |
| − | to an annotation by specifying its start or stop positions in clone,
| |
| − | link, superlink, or chromosome coordinates. The distributed
| |
| − | annotation system automatically converts any coordinate system into
| |
| − | any other. Because coordinates within clones are more stable to
| |
| − | revisions than coordinates within links or chromosomes, it is
| |
| − | recommended that annotation coordinates be stored relative to the
| |
| − | smallest sequencing unit.
| |
| − | The hierarchy is extensible. If the <cite>C. elegans</cite> gene
| |
| − | predictions were stable, it would make sense to store certain
| |
| − | annotations, such as the positions of exons, relative to the
| |
| − | transcriptional unit.
| |
| − | <h3><a name="ids">Reference sequence IDs</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Reference sequence IDs indicate a segment of the genome. They can
| |
| − | correspond to low-level primary sequences such as sequenced clones, or
| |
| − | to higher-level assemblies such as contigs.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | A reference ID can contain any set of printable characters (including
| |
| − | the space character), but not the colon character (":"), which is
| |
| − | reserved for separating reference IDs from sequence ranges (see
| |
| − | below). The newline, tab and carriage return characters are also
| |
| − | reserved for future use.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | A data source that uses the colon character for its internal IDs must
| |
| − | map this character to another one on the way out and on the way in.
| |
| − | For example:
| |
| − | | |
| − | <pre>
| |
| − | Client request server's internal id Response to client
| |
| − | | |
| − | gi-123456 --> gi:123456 ---> gi-123456
| |
| − | | |
| − | gi-123456:1,1000 --> gi:123456 start=1 stop=1000 ---> gi-123456:1,1000
| |
| − | | |
| − | </pre>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h2><a name="queries">The Queries</a></h2>
| |
| − | <h3><a name="SourcesCmd">Sources</a></h3><font color="red">DSN command has been deprecated in favour of the sources cmd</font>
| |
| − | <p>
| |
| − | In particular the following information for a DAS server is important:
| |
| − | | |
| − | <ul>
| |
| − | <li>The email address of the maintainer of a DAS source</li>
| |
| − | <li>The <a href="help_coordsys.jsp">coordinate system</a>(namespace) of the provided data</li>
| |
| − | <li>different properties that allow to describe a server closer</li>
| |
| − | </ul>
| |
| − | </p>
| |
| − | <br/>
| |
| − | | |
| − | <b>Scope:</b> all DAS servers
| |
| − | | |
| − | <br/>
| |
| − | | |
| − | <b>Command:</b> <i>sources</i>
| |
| − | | |
| − | <br/>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | <pre>
| |
| − | | |
| − | <i>PREFIX</i>/das[1]/sources
| |
| − | | |
| − | </pre>
| |
| − | | |
| − | The PREFIX can be either <b>das</b> or <b>das1</b> in order to refer to the major version 1 of the DAS protocol
| |
| − | and in order to provide support for the future das2 protocol.
| |
| − | <br/>
| |
| − | | |
| − | <br/>
| |
| − | <b>Description:</b> This query returns the meta information for a DAS server
| |
| − | <br/>
| |
| − | <b>Arguments:</b>
| |
| − | none
| |
| − | <br/>
| |
| − | | |
| − | <h4>Response:</h4>
| |
| − | | |
| − | | |
| − | <br/>
| |
| − | | |
| − | The response to the <i>sources</i> command is the "DASSSOURCE" XML-formatted document:
| |
| − | | |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version='1.0' encoding='UTF-8' ?>
| |
| − | <?xml-stylesheet type="text/xsl" href="das.xsl"?>
| |
| − | <SOURCES>
| |
| − | <SOURCE uri="URI" title="title" doc_href="URL" description="description">
| |
| − | <MAINTAINER email="email address" />
| |
| − | <VERSION uri="URI" created="date">
| |
| − | | |
| − | <COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string</COORDINATES>
| |
| − | <CAPABILITY type="das1:command" query_uri="URL" />
| |
| − | <PROP name="key" value="value" />
| |
| − | </VERSION>
| |
| − | </SOURCE>
| |
| − | </SOURCES>
| |
| − | </pre>
| |
| − | </blockquote>
| |
| − | | |
| − | | |
| − | | |
| − | <br/>
| |
| − | <b>Format:</b>
| |
| − | <div id="table">
| |
| − | <table class="dastable">
| |
| − | | |
| − | <tr id="row2">
| |
| − | <td>xml-stylesheet</td>
| |
| − | <td>optional</td>
| |
| − | <td>an XSL stylesheet that e.g. allows a browser to nicely display the XML response </td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row1">
| |
| − | <td>SOURCES</td>
| |
| − | <td>mandatory</td>
| |
| − | <td> the main container for several DAS sources</td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row2">
| |
| − | <td>SOURCE</td>
| |
| − | <td>mandatory, one or many</td>
| |
| − | <td>the description for a DAS datasource</td>
| |
| − | | |
| − | </tr>
| |
| − | | |
| − | <tr id="row1">
| |
| − | <td>uri</td>
| |
| − | <td>mandatory</td>
| |
| − | <td>a unique URI for the DAS source</td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row2">
| |
| − | <td>title, description</td>
| |
| − | <td>mandatory</td>
| |
| − | <td>the <i>nickname</i> under which a DAS server shall be known and displayed in a view.
| |
| − | The description is a free text description of the provided data</td>
| |
| − | | |
| − | </tr>
| |
| − | | |
| − | <tr id="row1">
| |
| − | <td>doc_href</td>
| |
| − | <td>optional</td>
| |
| − | <td>points to a web site where more information about a DAS source can get obtained.</td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row2">
| |
| − | <td>MAINTAINER, email</td>
| |
| − | <td>mandatory</td>
| |
| − | <td>the email address of the maintainer of this DAS source.</td>
| |
| − | | |
| − | </tr>
| |
| − | | |
| − | <tr id="row1">
| |
| − | <td>VERSION</td>
| |
| − | <td>mandatory</td>
| |
| − | <td>in principle this would allow hosting several versions of a DAS sources (with unque uris)
| |
| − | on a server, but in practise most people
| |
| − | provide only the server with the latest data. the created attribute provides the date on which a DAS server has been set up initially.
| |
| − | For a DAS registation server this is the date at which a DAS server has been pulished.
| |
| − | </td>
| |
| − | </tr>
| |
| − | | |
| − | | |
| − | | |
| − | <tr id="row2">
| |
| − | <td>COORDINATES</td>
| |
| − | <td>mandatory, one or many</td>
| |
| − | | |
| − | <td>The description of the namespace of a DAS source. <br/>
| |
| − | <b>uri</b> - the unique URI for a DAS source. For a DAS registration server these
| |
| − | should be resolvable and allow to access more information about this.
| |
| − | e.g. <a href="http://www.dasregistry.org/dasregistry/coordsys/CS_DS6">http://www.dasregistry.org/dasregistry/coordsys/CS_DS6</a>
| |
| − | for the UniProt,Protein Sequence coordinate system. <br/>
| |
| − | | |
| − | <b>source</b> - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available:
| |
| − | Chromosome, Clone, Contig, Gene_ID, NT_Contig, Protein Sequence, Protein Structure <br/>
| |
| − | | |
| − | <b>authority</b> - the authority, or institution that assigns the accession code for this namespace. In case of genome assemblies the authority that builds the assembly.
| |
| − | | |
| − | | |
| − | <b>version</b> - (optional) for genome assemblies the version of the build.<br/>
| |
| − | To learn more about coordinate systems, please see <a href="help_coords.jsp">here</a>.
| |
| − | | |
| − | </td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row1">
| |
| − | <td>CAPABILTIY</td>
| |
| − | <td>mandatory, one or many</td>
| |
| − | <td>The supported DAS commmand<br/>
| |
| − | | |
| − | <b>type</b> - the type of the DAS command. to distinguish DAS/1 from DAS/2 servers <i>das1:</i>
| |
| − | is used before the name of the command.<br/>
| |
| − | <b>query_uri</b>the URL of the server location, with the command attached. e.g. http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/features
| |
| − | Note: For some DAS commands this will not resolve, since e.g. for the features command the extension <pre>/features?segment=ID</pre> needs to be attached.
| |
| − | | |
| − | </td>
| |
| − | </tr>
| |
| − | | |
| − | <tr id="row2">
| |
| − | <td>PROP</td>
| |
| − | | |
| − | <td>optional, one or many</td>
| |
| − | <td>a free key- value style property that allows to add more tags to a server</td>
| |
| − | </tr>
| |
| − | | |
| − | </table>
| |
| − | </div>
| |
| − | | |
| − | <b>Example Responses</b>
| |
| − | | |
| − | <ul>
| |
| − | <li> <a href="http://www.dasregistry.org/das1/sources">http://www.dasregistry.org/das1/sources</a>
| |
| − | - the listing of DAS/1 sources at the DAS registration server</li>
| |
| − | | |
| − | <li> <a href="http://www.ensembl.org/das/sources">http://www.ensembl.org/das/sources</a>
| |
| − | - the DAS sources provided by Ensembl. The DAS registration server uses this listing
| |
| − | to automatically update the registration for these DAS servers.</li>
| |
| − | <li> <a href="http://vega.sanger.ac.uk/das/sources">http://vega.sanger.ac.uk/das/sources</a>
| |
| − | - the VEGA DAS sources</li>
| |
| − | </ul>
| |
| − | | |
| − | | |
| − | | |
| − | </div>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This section lists the queries recognized by reference and annotation
| |
| − | servers. Each of these queries begins with some site-specific prefix,
| |
| − | denoted here as <i>PREFIX</i>. The other meta-variable used in these
| |
| − | examples is <i>DSN</i>, which is a symbolic data source. (As seen
| |
| − | the the <a href="#request" target="request"> above example.</a>)
| |
| − | Data sources are standardized across DAS servers
| |
| − | in such a way that a data source name has a one-to-one correspondence with
| |
| − | a reference sequence.
| |
| − | | |
| − | | |
| − | | |
| − | <h3><a name="entry">Retrieve the List of Entry Points for a Data Source <font color="red">This Entry_Points cmd is now mandatory for reference servers.</font></a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Scope:</b> Reference servers.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Command:</b> <i>entry_points</i>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | <blockquote><pre>
| |
| − | <i>PREFIX</i>/das/<i>DSN</i>/entry_points
| |
| − | | |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Description:</b> This query returns the list of sequence entry points available and
| |
| − | their sizes in base pairs.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Arguments:</b>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <h4>Response:</h4>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The response to the <i>entry_points</i> command is the "DASEP" XML-formatted document:
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | | |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version="1.0" standalone="no"?>
| |
| − | <!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
| |
| − | <DASEP>
| |
| − | <ENTRY_POINTS href="<i>url</i>" version="<i>X.XX</i>">
| |
| − | <SEGMENT id="<i>id1</i>" start="<i>start1</i>" stop="<i>stop1</i>" type="type" orientation="+">descriptive text</SEGMENT>
| |
| − | | |
| − | <SEGMENT id="<i>id2</i>" start="<i>start2</i>" stop="<i>stop2</i>" type="type" orientation="+">descriptive text</SEGMENT>
| |
| − | <SEGMENT id="<i>id3</i>" start="<i>start3</i>" stop="<i>stop3</i>" type="type" orientation="+">descriptive text</SEGMENT>
| |
| − | | |
| − | ...
| |
| − | </ENTRY_POINTS>
| |
| − | </DASEP>
| |
| − | </pre></blockquote>
| |
| − | <p>
| |
| − | | |
| − | <dl>
| |
| − | <dt><!DOCTYPE> (required; one only)
| |
| − | <dd>The doctype indicates which formal DTD specification to use.
| |
| − | For the entry_points query, the doctype DTD is "http://www.biodas.org/dtd/dasep.dtd".
| |
| − | <p>
| |
| − | <dt><DASEP> (required, one only)
| |
| − | <dd>The appropriate doctype and root tag is DASEP.
| |
| − | <p>
| |
| − | | |
| − | <dt><ENTRY_POINTS> (required, only one)
| |
| − | <dd>There is a single <ENTRY_POINTS> tag. It has a version
| |
| − | number (required) in the form "N.NN". Whenever the
| |
| − | DNA of the entry point changes, the version number should change as well.
| |
| − | <p>
| |
| − | The <b>href</b> (required) attribute echoes the URL query that
| |
| − | was used to fetch the current document.
| |
| − | <p>
| |
| − | <dt><SEGMENT> (optional; zero or more)
| |
| − | <dd>Each segment contains the attributes <b>id</b>, <b>start</b>, <b>stop</b>
| |
| − | and <b>orientation</b>. The id is a unique identifier, which can be used as
| |
| − | the reference ID in further requests to DAS. The start and stop indicate the
| |
| − | start and stop positions of the segment. <font color="red">The start and stop are now optional</font>. Orientation is one of "+" or "-" and
| |
| − | indicates the strandedness of the segment (use "+" if the segment is not intrinsically
| |
| − | ordered).<font color="red">The orientation is now optional.</font>.
| |
| − | <p>
| |
| − | | |
| − | <font color="red">The subparts section is now deprecated?</font>If the optional <b>subparts</b> attribute is present and has the value "yes",
| |
| − | it indicates that the segment has subparts.
| |
| − | <p>
| |
| − | <font color="red">The type should now be a SO type if possible?</font>
| |
| − | If the optional <b>type</b> attribute is present, it can be used to describe the
| |
| − | type of the segment (for future compatibility with Sequence Ontology-based feature
| |
| − | typing).
| |
| − | <p>
| |
| − | For compatibility with older versions of the specification, the <SEGMENT>
| |
| − | tag can use a <b>size</b> attribute rather than <b>start</b> and <b>stop</b>, and
| |
| − | can omit the <b>orientation</b> attribute:
| |
| − | <pre>
| |
| − | | |
| − | <SEGMENT id="id" size="123456">
| |
| − | </pre>
| |
| − | In this case, the start is implied to be "1" and the stop is implied to be the same
| |
| − | as the length.
| |
| − | </dl>
| |
| − | | |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><font color="red">Retrieve the DNA Associated with a Subsequence has been deprecated as the sequence cmd below is more commonly used.</font></h3>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><a name="sequence">Retrieve the Sequence Associated with a Subsequence</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Scope:</b> Reference servers.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Command:</b> <i>sequence</i>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | | |
| − | <blockquote><pre>
| |
| − | <i>PREFIX</i>/das/<i>DSN</i>/sequence?segment=<i>RANGE</i>[;segment=<i>RANGE</i>...]
| |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Description:</b> This query returns the sequence (nucleotide or
| |
| − | protein) corresponding to the indicated segment.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Arguments:</b>
| |
| − | | |
| − | <dl>
| |
| − | <dt><b>segment</b> (required; one or more)
| |
| − | <dd>This is the sequence range. It uses the format format <i>reference:start,stop</i>, where
| |
| − | <i>reference</i> is the ID of the reference sequence used to establish the coordinate
| |
| − | system, and <i>start</i> and <i>stop</i> are the endpoints of the region to query, inclusive.
| |
| − | If the start and stop positions are not provided, then the entire reference sequence is
| |
| − | returned.
| |
| − | | |
| − | </dl>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Here is an example of a valid request that uses the <b>segment</b>
| |
| − | argument to fetch three independent segments. The last segment is a
| |
| − | subsequence:
| |
| − | | |
| − | <pre>
| |
| − | http://www.wormbase.org/db/das/elegans/sequence?
| |
| − | segment=BUM;segment=HUM_HGA;segment=CE_HOC2:1,200
| |
| − | </pre>
| |
| − | | |
| − | <h4>The Sequence Response</a></h4>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The response to <i>dna</i> is the "DASSEQUENCE" XML-formatted document.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version="1.0" standalone="no"?>
| |
| − | <!DOCTYPE DASSEQUENCE SYSTEM "http://www.biodas.org/dtd/dassequence.dtd">
| |
| − | <DASSEQUENCE>
| |
| − | | |
| − | <SEQUENCE id="<i>id</i>" start="<i>start</i>" stop="<i>stop</i>"
| |
| − | moltype="<i>moltype</i>" version="X.XX">
| |
| − | atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
| |
| − | taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
| |
| − | agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa
| |
| − | taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa
| |
| − | aaatgagaaaaatcgacgaaaatcggtataaaatcaaataaaaatagaaggaaaatattc
| |
| − | agctcgtaaacccacacgtgcggcacggtttcgtgggcggggcgtctctgccgggaaaat
| |
| − | tttgcgtttaaaaactcacatataggcatccaatggattttcggattttaaaaattaata
| |
| − | taaaatcagggaaatttttttaaattttttcacatcgatattcggtatcaggggcaaaat
| |
| − | tagagtcagaaacatatatttccccacaaactctactccccctttaaacaaagcaaagag
| |
| − | cgatactcattgcctgtagcctctatattatgccttatgggaatgcatttgattgtttcc
| |
| − | gcatattgtttacaaccatttatacaacatgtgacgtagacgcactgggcggttgtaaaa
| |
| − | cctgacagaaagaattggtcccgtcatctactttctgattttttggaaaatatgtacaat
| |
| − | gtcgtccagtattctattccttctcggcgatttggccaagttattcaaacacgtataaat
| |
| − | aaaaatcaataaagctaggaaaatattttcagccatcacaaagtttcgtcagccttgtta
| |
| − | tgtcaaccactttttatacaaattatataaccagaaatactattaaataagtatttgtat
| |
| − | gaaacaatgaacactattataacattttcagaaaatgtagtatttaagcgaaggtagtgc
| |
| − | acatcaaggccgtcaaacggaaaaatttttgcaagaatca
| |
| − | </SEQUENCE>
| |
| − | </DASDNA>
| |
| − | | |
| − | </pre></blockquote>
| |
| − | <p>
| |
| − | | |
| − | <dl>
| |
| − | <dt><!DOCTYPE> (required; one only)
| |
| − | <dd>The doctype indicates which formal DTD specification to use.
| |
| − | For the sequence query, the doctype DTD is "http://www.biodas.org/dtd/dassequence.dtd".
| |
| − | <p>
| |
| − | <dt><DASSEQUENCE> (required; one only)
| |
| − | <dd>The appropriate doctype and root tag is DASSEQUENCE.
| |
| − | <p>
| |
| − | <dt><SEQUENCE> (required; one or more)
| |
| − | <dd>There is a single <SEQUENCES> tag per requested segment. It has the
| |
| − | attributes <b>id</b>, which indicates the reference ID for this sequence,
| |
| − | <b>start</b> and <b>stop</b>, which indicate the position of
| |
| − | this segment within the reference sequence, <b>moltype</b>,
| |
| − | which indicates the molecular type of the sequence, and <b>version</b>,
| |
| − | which provides the sequence map version number. All five
| |
| − | attributes are required.
| |
| − | <p>
| |
| − | | |
| − | The molecule type is one of <i>DNA</i>, <i>ssRNA</i>,
| |
| − | <i>dsRNA</i>, or <i>Protein</i>. No provision is made for
| |
| − | circular molecules.
| |
| − | <p>
| |
| − | The content of this tag is the sequence itself, using standard
| |
| − | IUPAC codes for DNA, RNA and protein.
| |
| − | </dl>
| |
| − | | |
| − | | |
| − | </td>
| |
| − | | |
| − | </tr>
| |
| − | </table>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><a name="types">Retrieve the Types Available for a Segment</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Scope:</b> Annotation and reference servers.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Command:</b> <i>types</i>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | | |
| − | <blockquote><pre>
| |
| − | <i>PREFIX</i>/das/<i>DSN</i>/types [?segment=<i>RANGE</i>]
| |
| − | [;segment=<i>RANGE</i>]
| |
| − | [;type=<i>TYPE</i>]
| |
| − | [;type=<i>TYPE</i>]
| |
| − | | |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Description:</b> This query returns the annotation available for a segment of sequence.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Arguments:</b>
| |
| − | | |
| − | <dl>
| |
| − | <dt><b>segment</b> (optional)
| |
| − | <dd>This is the sequence range. It uses the format format <i>reference:start,stop</i>, where
| |
| − | <i>reference</i> is the ID of the reference sequence used to establish the coordinate
| |
| − | system, and <i>start</i> and <i>stop</i> are the endpoints of the region to query, inclusive.
| |
| − | <p>
| |
| − | | |
| − | <dt><b>type</b> (optional)
| |
| − | <dd>One or more type IDs to be used for filtering annotations on the type
| |
| − | field. If multiple type names are provided, the resulting list of features
| |
| − | will be the logical OR of the list.
| |
| − | <p>
| |
| − | For compatibility with versions 0.997 and earlier of this protocol, servers
| |
| − | are allowed to treat the type ID as a regular expression, but this feature is
| |
| − | <b>deprecated</b> and should not be used.
| |
| − | </dl>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | If one or more segment arguments are provided, the list of types
| |
| − | returned is restricted to the indicated segments. If no segment
| |
| − | argument is provided, then <b>all</b> feature types known to the
| |
| − | source are returned.
| |
| − | | |
| − | | |
| − | <h4>Response:</h4>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The document returned from the <i>types</i> request is an
| |
| − | XML-formatted "DASTYPES" documents. This is a shortened form of the
| |
| − | full features format (see below) and is used to summarize the type and
| |
| − | number of each annotation. Annotation types can be grouped into
| |
| − | segments, or be totaled across the entire database.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version="1.0" standalone="no"?>
| |
| − | <!DOCTYPE DASTYPES SYSTEM "http://www.biodas.org/dtd/dastypes.dtd">
| |
| − | | |
| − | <DASTYPES>
| |
| − | <GFF version="1.0" href="url">
| |
| − | <SEGMENT id="<i>id</i>" start="<i>start</i>" stop="<i>stop</i>" type="<i>type</i>" version="X.XX" label="<i>label</i>">
| |
| − | | |
| − | <TYPE id="<i>id1</i>" method="<i>method</i>" category="<i>category</i>"><i>Type Count 1</i></TYPE>
| |
| − | <TYPE id="<i>id2</i>" method="<i>method</i>" category="<i>category</i>"><i>Type Count 2</i></TYPE>
| |
| − | | |
| − | ...
| |
| − | </SEGMENT>
| |
| − | </GFF>
| |
| − | </DASTYPES>
| |
| − | </pre></blockquote>
| |
| − | <p>
| |
| − | | |
| − | | |
| − | <dl>
| |
| − | <dt><!DOCTYPE> (required; one only)
| |
| − | <dd>The doctype indicates which formal DTD specification to use.
| |
| − | For the types query, the doctype DTD is "http://www.biodas.org/dtd/dastypes.dtd".
| |
| − | <p>
| |
| − | | |
| − | <dt><DASTYPES> (required; one only)
| |
| − | <dd>The appropriate doctype and root tag is DASTYPES.
| |
| − | <p>
| |
| − | <dt><GFF> (required; one only)
| |
| − | <dd>There is a single <GFF> tag. Its <b>version</b> (required)
| |
| − | attribute indicates the current version of the XML form of the
| |
| − | General Feature Format. The current version is (arbitrarily) 1.0.
| |
| − | The <b>href</b> (required) attribute
| |
| − | echoes the URL query that was used to fetch the current document.
| |
| − | <p>
| |
| − | | |
| − | <dt><SEGMENT> (required; one or more)
| |
| − | <dd>The <SEGMENT> tag provides information
| |
| − | on the reference segment. The <b>id</b>, <b>start</b> and <b>stop</b>
| |
| − | attributes indicate the coordinate system of the segment, and are required
| |
| − | if the segment corresponds to a defined region of the genome, optional if
| |
| − | the list of types corresponds to the entire database.
| |
| − | The <b>version</b> attribute (required) indicates the current version of
| |
| − | the sequence map. The optional <b>label</b> attribute supplies a human readable label
| |
| − | for display purposes. The optional <t>type</b> attribute describes the segment
| |
| − | type, for future compatibility with Sequence Ontology-based feature typing.
| |
| − | <p>
| |
| − | | |
| − | <dt><TYPE> (optional; zero or more per SEGMENT)
| |
| − | <dd>Each segment has zero or more <TYPE> tags, which summarize
| |
| − | the types of annotation available. The attributes are
| |
| − | <b>id</b> (required), which is a unique id for the annotation type and
| |
| − | can be used to retrieve further information from the annotation
| |
| − | server (see <a href="#feature_linking">Linking to a
| |
| − | Feature</a>), <b>method</b> (optional), which indicates the method (subtype)
| |
| − | for the feature type and the <b>category</b> (optional)
| |
| − | attribute, which provides functional
| |
| − | grouping to related types. The tag contents (optional) is
| |
| − | a count of the number of features of this type across the segment.
| |
| − | | |
| − | </dl>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><a name="features">Retrieve the Annotations Across a Segment</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Scope:</b> Reference and annotation servers.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Command:</b> <i>features</i>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | | |
| − | <blockquote><pre>
| |
| − | <i>PREFIX</i>/das/<i>DSN</i>/features?segment=<i>REF:start,stop</i>[;segment=<i>REF:start,stop</i>...]
| |
| − | [;type=<i>TYPE</i>]
| |
| − | [;type=<i>TYPE</i>]
| |
| − | [;category=<i>CATEGORY</i>]
| |
| − | [;category=<i>CATEGORY</i>]
| |
| − | [;categorize=<i>yes|no</i>]
| |
| − | <font style="background-color: #DEB887">[;feature_id=ID]</font>
| |
| − | | |
| − | <font style="background-color: #DEB887">[;group_id=ID]</font>
| |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Description:</b> This query returns the annotations across one or more segments of sequence.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Arguments:</b>
| |
| − | | |
| − | <dl>
| |
| − | <dt><b>segment</b> (<font style="background-color: #DEB887">zero</font> or more)
| |
| − | <dd>If specified, the segment argument restricts the list of annotations to those that
| |
| − | overlap the indicated range. Each segment argument uses the format format
| |
| − | <i>reference:start,stop</i>, where
| |
| − | <i>reference</i> is the ID of the reference sequence used to establish the coordinate
| |
| − | system, and <i>start</i> and <i>stop</i> are the endpoints of
| |
| − | the region to query, inclusive. Multiple segments may be specified.
| |
| − | <p>
| |
| − | | |
| − | <dt><b>type</b> (zero or more)
| |
| − | <dd>Zero or more type IDs to be used for filtering annotations on the type
| |
| − | field. If multiple type names are provided, the resulting list of features
| |
| − | will be the logical OR of the list.
| |
| − | <p>
| |
| − | For compatibility with versions 0.997 and earlier of this protocol, servers
| |
| − | are allowed to treat the type ID as a regular expression, but this feature is
| |
| − | <b>deprecated</b> and should not be relied on.
| |
| − | <dt><b>category</b> (zero or more)
| |
| − | <dd>Zero or more category IDs to be used for filtering annotations by category.
| |
| − | If multiple categories are provided, they are treated as the logical OR.
| |
| − | <p>
| |
| − | For compatibility with versions 0.997 and earlier of this protocol, servers
| |
| − | are allowed to treat the type ID as a regular expression, but this feature is
| |
| − | <b>deprecated</b> and should not be relied on.
| |
| − | <p>
| |
| − | | |
| − | <dt><b>categorize</b> (optional)
| |
| − | <dd>Either "yes" or "no" (default). If "yes", then each annotation
| |
| − | must include its functional category.
| |
| − | <dt><b style="background-color: #DEB887">feature_id</b><font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
| |
| − | <dd style="background-color: #DEB887">
| |
| − | Instead of, or in addition to, <b>segment</b> arguments, you may
| |
| − | provide one or more <b>feature_id</b> arguments, whose values
| |
| − | are the identifiers of particular features. If the server
| |
| − | supports this operation, it will translate the feature ID into
| |
| − | the segment(s) that strictly enclose them and return the result
| |
| − | in the <i>features</i> response. It is possible for the server
| |
| − | to return multiple segments if the requested feature is present
| |
| − | in multiple locations.
| |
| − | </dd>
| |
| − | | |
| − | <dt><b style="background-color: #DEB887">group_id</b><font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
| |
| − | <dd style="background-color: #DEB887">
| |
| − | The <b>group_id</b> argument, is similar to <b>feature_id</b>, but
| |
| − | retrieves segments that contain the indicated feature group.
| |
| − | </dd>
| |
| − | </dl>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Annotation servers are only required to return annotations which are
| |
| − | completely contained within the indicated segment. Servers <b>may</b>
| |
| − | also return annotations which overlap the segment, but are not
| |
| − | completely contained within them. Annotations <b>must</b> be returned
| |
| − | using the coordinate system in which they were requested. For
| |
| − | example, if a contig ID was used to specify the segment, then the
| |
| − | annotation endpoints must use contig coordinates.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | If multiple segment arguments are provided and they happen to overlap,
| |
| − | then the annotation server may return the same annotation multiple
| |
| − | times, possibly using different coordinate systems. It is the
| |
| − | responsibility of the client to merge annotations based on the
| |
| − | assembly.
| |
| − | | |
| − | <h4><a name="return_feats">Response:</a></h4>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The document returned from the <i>features</i> request is an
| |
| − | XML-formatted "DASGFF" document.
| |
| − | </p>
| |
| − | | |
| − | <p>
| |
| − | <b>Format:</b>
| |
| − | </p>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version="1.0" standalone="no"?>
| |
| − | | |
| − | <!DOCTYPE DASGFF SYSTEM "http://www.biodas.org/dtd/dasgff.dtd">
| |
| − | <DASGFF>
| |
| − | <GFF version="1.0" href="url">
| |
| − | <SEGMENT id="<i>id</i>" start="<i>start</i>" stop="<i>stop</i>" type="<i>type</i>" version="X.XX" label="<i>label</i>">
| |
| − | | |
| − | <FEATURE id="<i>id</i>" label="<i>label</i>">
| |
| − | <TYPE id="<i>id</i>" category="<i>category</i>" reference="<i>yes|no</i>"><i>type label</i></TYPE>
| |
| − | | |
| − | <METHOD id="<i>id</i>"><i> method label </i></METHOD>
| |
| − | <START><i> start</i> </START>
| |
| − | <END><i> end</i> </END>
| |
| − | | |
| − | <SCORE><i> [X.XX|-]</i> </SCORE>
| |
| − | <ORIENTATION> [0|-|+] </ORIENTATION>
| |
| − | <PHASE> [0|1|2|-]</PHASE>
| |
| − | | |
| − | <NOTE> <i>note text</i> </NOTE>
| |
| − | <LINK href="<i>url</i>"> <i>link text</i> </LINK>
| |
| − | <TARGET id="id" start="x" stop="y"><i>target name</i></TARGET>
| |
| − | | |
| − | <GROUP id="<i>id</i>" label="<i>label</i>" type="<i>type</i>">
| |
| − | <NOTE> <i>note text</i> </NOTE>
| |
| − | <LINK href="<i>url</i>"> <i>link text</i> </LINK>
| |
| − | | |
| − | <TARGET id="id" start="x" stop="y"><i>target name</i></TARGET>
| |
| − | </GROUP>
| |
| − | </FEATURE>
| |
| − | ...
| |
| − | </SEGMENT>
| |
| − | </GFF>
| |
| − | | |
| − | </DASGFF>
| |
| − | </pre></blockquote>
| |
| − | <p>
| |
| − | | |
| − | <dl>
| |
| − | <dt><!DOCTYPE> (required; one only)
| |
| − | <dd><font color="red">Doctype should now be XSD not DTD.</font>The doctype indicates which formal DTD specification to use.
| |
| − | For the features query, the doctype DTD is "http://www.biodas.org/dtd/dasgff.dtd".
| |
| − | <p>
| |
| − | <dt><DASGFF> (required; one only)
| |
| − | <dd>The appropriate doctype and root tag is DASGFF.
| |
| − | <p>
| |
| − | | |
| − | <dt><GFF> (required; one only)
| |
| − | <dd>There is a single <GFF> tag. Its <b>version</b> (required)
| |
| − | attribute indicates the current version of the XML form of the
| |
| − | General Feature Format. The current version is (arbitrarily) 1.0
| |
| − | The <b>href</b> (required) attribute
| |
| − | echoes the URL query that was used to fetch the current document.
| |
| − | <p>
| |
| − | <dt><SEGMENT> (required; one or more)
| |
| − | <dd>The <SEGMENT> tag provides information
| |
| − | on the reference segment coordinate system.
| |
| − | The <b>id</b>, <b>start</b> and <b>stop</b>
| |
| − | | |
| − | attributes indicate the position of the segment. The <b>version</b>
| |
| − | attribute indicates the current version of the sequence map. The
| |
| − | id, start, stop, and version attributes are required. The optional
| |
| − | <b>label</b> attribute provides a human readable label for display purposes.
| |
| − | The optional <t>type</b> attribute describes the segment
| |
| − | type, for future compatibility with Sequence Ontology-based feature typing.
| |
| − | <p>
| |
| − | <dt><FEATURE> (optional; zero or more per SEGMENT)
| |
| − | <dd>There are zero or more <FEATURE> tags per <SEGMENT>,
| |
| − | each providing information on one annotation. The
| |
| − | <b>id</b> attribute (required) is a unique identifier for the feature.
| |
| − | It can be used as a reference point for further navigation.
| |
| − | The <b>label</b> attribute (optional) is a suggested label to
| |
| − | display for the feature. If not present, the <b>id</b> attribute can be
| |
| − | used instead.
| |
| − | <p>
| |
| − | | |
| − | <dt><TYPE> (required; one per FEATURE)
| |
| − | <dd>Each feature has just one <TYPE> field, which indicates the type of the
| |
| − | annotation. The attributes are <b>id</b> (required), which is a unique id for the
| |
| − | annotation type and can be used to retrieve further information from the
| |
| − | annotation server (see <a href="#feature_linking">Linking to a Feature</a>), and
| |
| − | the <b>category</b> (optional, recommended) attribute, which provides functional grouping
| |
| − | to related types.
| |
| − | <p>
| |
| − | | |
| − | <font color="red">Remove this whole section??? The reference server's annotations can consist of
| |
| − | additional overlapping landmarks (parents, children, and neighbors),
| |
| − | which should be marked "yes" in the third attribute <b>reference</b>
| |
| − | (optional, defaults to "no") to indicate that the feature is a
| |
| − | structural landmark within the map (this feature can be annotated).
| |
| − | The tag contents (optional) is a human readable label for
| |
| − | display purposes.
| |
| − | <p>
| |
| − | If a <b>reference</b> annotation has either or both of the optional attributes,
| |
| − | <b>subparts="yes"</b> and <b>superparts="yes"</b>, then in
| |
| − | addition to being useable as a
| |
| − | reference sequence, the feature contains subparts and/or
| |
| − | superparts that themselves can act as reference features. This can be used to reconstruct
| |
| − | reference server's assembly. See also <a
| |
| − | href="#fetching_assembly">Fetching Assembly Information</a>.
| |
| − | </font>
| |
| − | <p>
| |
| − | | |
| − | <dt><METHOD> (required; one per FEATURE)
| |
| − | <dd>Each feature has one <METHOD> field, which identifies the method used
| |
| − | to identify the feature. The <b>id</b> (optional) tag can be used to retrieve further information
| |
| − | from the annotation server. The tag contents (optional) is a human readable label.
| |
| − | <p>
| |
| − | <dt><START>, <END> (<font color="red">Now Optional</font>; one apiece per FEATURE)
| |
| − | <dd>These tags indicate the start and end of the feature in the coordinate system of
| |
| − | the reference sequence given in the <SEGMENT> tag. The
| |
| − | relationship between the feature start and stop positions and
| |
| − | the segment start and stop is that the two spans are guaranteed to overlap.
| |
| − | <p>
| |
| − | | |
| − | <dt><SCORE> (<font color="red">Now Optional</font>; one per FEATURE)
| |
| − | <dd>This is a floating point number indicating the "score" of the method used to find
| |
| − | the current feature. The number can only be understood in
| |
| − | the context of information retrieved from the server by linking to the method.
| |
| − | If this field is inapplicable, the contents of the tag can be
| |
| − | replaced with a <b>-</b> symbol.
| |
| − | <p>
| |
| − | <dt><ORIENTATION> (<font color="red">Now Optional</font>; one per FEATURE)
| |
| − | <dd>This tag indicates the orientation of the feature relative to the direction of
| |
| − | transcription. It may be <b>0</b> for features that are unrelated to transcription,
| |
| − | <b>+</b>, for features that are on the sense strand, and <b>-</b>, for features on the
| |
| − | antisense strand.
| |
| − | <p>
| |
| − | | |
| − | <dt><PHASE> (<font color="red">Now Optional</font>; one per FEATURE)
| |
| − | <dd>This tag indicates the position of the feature relative to open reading frame, if
| |
| − | any. It may be one of the integers <b>0</b>, <b>1</b> or
| |
| − | <b>2</b>, corresponding to each of the three reading frames, or <b>-</b> if the
| |
| − | feature is unrelated to a reading frame.
| |
| − | <p>
| |
| − | <dt><NOTE> (optional; zero or more per FEATURE)
| |
| − | <dd>A human-readable note in plain text format.
| |
| − | <p>
| |
| − | | |
| − | <dt><LINK> (optional; zero or more per FEATURE)
| |
| − | <dd>A link to a web page somewhere that provides more information about this feature. The
| |
| − | <b>href</b> (required) attribute provides the URL target for the link. The
| |
| − | link text is an optional human readable label for display
| |
| − | purposes.
| |
| − | <p>
| |
| − | <dt><TARGET> (optional; zero or more per FEATURE)
| |
| − | <dd>The target sequence in a sequence similarity match. The <b>id</b> attribute provides the
| |
| − | reference ID for the target sequence, and the <b>start</b> and <b>stop</b> attributes
| |
| − | indicate the segment that matched across the target sequence. All
| |
| − | three attributes are required.
| |
| − | More information on the
| |
| − | target can be retrieved by linking back to the annotation
| |
| − | server. See <a href="#feature_linking">Linking to a Feature</a>.
| |
| − | <p>
| |
| − | | |
| − | <dt><GROUP> (optional; zero or more per FEATURE)
| |
| − | <dd>The <GROUP> section is slightly odd, as it is derived from an overloaded
| |
| − | field in the GFF flat file format. It provides a unique "group" ID that indicates
| |
| − | when certain features are related to each other. The canonical
| |
| − | example is the CDS, exons and introns of a transcribed gene, which logically
| |
| − | belong together.
| |
| − | | |
| − | <p>
| |
| − | The group <b>id</b> attribute (required) provides an identifier that
| |
| − | should be used by the client to group features together visually. Unlike other
| |
| − | IDs in this protocol, the group ID cannot be used as a database handle to retrieve
| |
| − | further information about the group. Such information can,
| |
| − | however, be provided within <GROUP> section, which may contain up
| |
| − | to three optional tags.
| |
| − | <p>
| |
| − | | |
| − | The <b>label</b> attribute (optional) provides a human-readable string that can be
| |
| − | used in graphical representations to label the glyph.
| |
| − | <p>
| |
| − | The <b>type</b> attribute (optional) provides a type ID for the group as a whole,
| |
| − | for example "transcript". This ID can be used as a key into the
| |
| − | <a href="#stylesheet">stylesheet</a> to select the glyph and graphical characteristics for the
| |
| − | group as a whole.
| |
| − | <p>
| |
| − | <dl>
| |
| − | | |
| − | <dt><NOTE> (optional; zero or more per GROUP)
| |
| − | <dd>A human-readable note in plain text format.
| |
| − | <p>
| |
| − | <dt><LINK> (optional; zero or more per GROUP)
| |
| − | <dd>A link to a web page somewhere that provides more information about this group. The
| |
| − | <b>href</b> (required) attribute provides the URL target for the link. The
| |
| − | link text is an optional human readable label for display purposes.
| |
| − | <p>
| |
| − | <dt><TARGET> (optional; zero or more per GROUP)
| |
| − | <dd>The target sequence in a sequence similarity match. The <b>id</b> attribute provides the
| |
| − | reference ID for the target sequence, and the <b>start</b> and <b>stop</b> attributes
| |
| − | indicate the segment that matched across the target sequence. All
| |
| − | three attributes are required. NOTE: although this tag is present in the GROUP section,
| |
| − | it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE>
| |
| − | | |
| − | section. Earlier versions of this specification placed the
| |
| − | TARGET tag in the GROUP section, and clients must recognize and
| |
| − | accomodate this.
| |
| − | </dl>
| |
| − | | |
| − | </dl>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <table bgcolor="#DEB887" border="1">
| |
| − | <tr><th>New in version 1.5: Exception Handling for Invalid Segments</th></tr>
| |
| − | <tr><td>
| |
| − | The request for a named segment may fail because: (1) the
| |
| − | reference sequence is not known to the server or (2) the
| |
| − | requested region is outside the bounds of the segment. In both
| |
| − | cases, an exception is indicated.
| |
| − | <p>
| |
| − | | |
| − | In the case of a reference server, which is expected to be
| |
| − | authoritative for the map, the <GFF> section will flag the
| |
| − | problem by issuing an <ERRORSEGMENT> tag instead of the
| |
| − | usual <SEGMENT> tag. This tag has the following format:
| |
| − | <p>
| |
| − | <blockquote>
| |
| − | <pre><ERRORSEGMENT id="id" start="start" stop="stop"></pre>
| |
| − | | |
| − | </blockquote>
| |
| − | <p>
| |
| − | The <b>id</b> attribute (required) corresponds to the ID of the
| |
| − | requested segment, and <b>start</b> and <b>stop</b> (optional)
| |
| − | correspond to the requested bounds of the segment if this was
| |
| − | specified in the request.
| |
| − | <p>
| |
| − | Unlike a reference server, an annotation server is not required
| |
| − | to know the identities of all the segments. Therefore when
| |
| − | presented with a segment ID that it doesn't recognize, it can't
| |
| − | know whether this is a true client error or merely an unannotated segment.
| |
| − | In this case, an annotation server will issue an
| |
| − | <UNKNOWNSEGMENT> tag. This tag has the same syntax as
| |
| − | <ERRORSEGMENT> but doesn't necessarily imply an error.
| |
| − | <p>
| |
| − | | |
| − | If an annotation server detects a request for a region outside
| |
| − | the bounds of a segment that it has annotated, it will issue an
| |
| − | <ERRORSEGMENT> exception.
| |
| − | <p>
| |
| − | In the case of a request for multiple segments, the server will
| |
| − | return a mixture of <SEGMENT> sections for valid segments,
| |
| − | and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for
| |
| − | invalid ones.
| |
| − | </td>
| |
| − | | |
| − | </tr>
| |
| − | </table>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><font color="red">Linking to a Feature has now been deprecated, this section no longer exists</a></font></h3>
| |
| − | | |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h3><a name="retrieving_stylesheet">Retrieving the Stylesheet</a></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Scope:</b> Annotation servers.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Command:</b> <i>stylesheet</i>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | | |
| − | <blockquote><pre>
| |
| − | <i>PREFIX</i>/das/<i>DSN</i>/stylesheet
| |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Description:</b> This query can be issued to an annotation server in order to retrieve
| |
| − | the server's recommendations on formatting annotations retrieved from
| |
| − | it. These recommendations are not normative. A viewer is free to use
| |
| − | any display format it chooses.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Arguments:</b> None.
| |
| − | | |
| − | | |
| − | <p>
| |
| − | | |
| − | <h4><a name="stylesheet">Response:</a></h4>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This document is intended to provide hints to the annotation display
| |
| − | client. It maps feature categories and individual types to a series
| |
| − | of glyphs known to the display client.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <b>Format:</b>
| |
| − | <p>
| |
| − | | |
| − | <blockquote>
| |
| − | <pre>
| |
| − | <?xml version="1.0" standalone="no"?>
| |
| − | | |
| − | <!DOCTYPE DASSTYLE SYSTEM "http://www.biodas.org/dtd/dasstyle.dtd">
| |
| − | <DASSTYLE>
| |
| − | <STYLESHEET version="X.XX">
| |
| − | | |
| − | <CATEGORY id="default">
| |
| − | <TYPE id="default">
| |
| − | <GLYPH zoom="high">
| |
| − | | |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | | |
| − | </GLYPH>
| |
| − | <GLYPH zoom="medium">
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | | |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | <GLYPH zoom="low">
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | | |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | </CATEGORY>
| |
| − | | |
| − | <CATEGORY id="group">
| |
| − | <TYPE id="group_id1">
| |
| − | <GLYPH zoom="high">
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | | |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | ...
| |
| − | </CATEGORY>
| |
| − | | |
| − | | |
| − | <CATEGORY id="<i>category1</i>">
| |
| − | <TYPE id="<i>default</i>">
| |
| − | <GLYPH>
| |
| − | <<i>ID</i>>
| |
| − | | |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | <TYPE id="<i>type1</i>">
| |
| − | | |
| − | <GLYPH>
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | | |
| − | </TYPE>
| |
| − | <TYPE id="<i>type2</i>">
| |
| − | <GLYPH>
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | | |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | ...
| |
| − | </CATEGORY>
| |
| − | | |
| − | <CATEGORY id="<i>category2</i>">
| |
| − | | |
| − | <TYPE id="<i>default</i>">
| |
| − | <GLYPH>
| |
| − | <<i>ID</i>>
| |
| − | <<i>ATTR</i>><i>value</i></ATTR>
| |
| − | ...
| |
| − | </<i>ID</i>>
| |
| − | | |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | ...
| |
| − | </CATEGORY>
| |
| − | ...
| |
| − | | |
| − | </STYLESHEET>
| |
| − | </DASSTYLE>
| |
| − | </pre></blockquote>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <dl>
| |
| − | <dt><!DOCTYPE> (required; one only)
| |
| − | <dd>The doctype indicates which formal DTD specification to use.
| |
| − | For the stylesheet query, the doctype DTD is "http://www.biodas.org/dtd/dasstyle.dtd".
| |
| − | <p>
| |
| − | <dt><DASSTYLE> (required; one only)
| |
| − | <dd>The appropriate doctype and root tag is DASSTYLE.
| |
| − | <p>
| |
| − | <dt><STYLESHEET> (required; one only)
| |
| − | <dd>There is a single <STYLESHEET> tag. Its <b>version </b>
| |
| − | | |
| − | (required)
| |
| − | attribute indicates the current version of the stylesheet, and
| |
| − | can be used for caching purposes.
| |
| − | <p>
| |
| − | <dt><CATEGORY> (required; one or more)
| |
| − | <dd>There are one or more <CATEGORY> tags, each providing information
| |
| − | on the display of a high-level feature category. The <b>id</b>
| |
| − | (required)
| |
| − | tag uniquely names the category. A special name is "default", which
| |
| − | tells the annotation viewer what format to use for categories that
| |
| − | are not otherwise specified in the stylesheet. Another special name
| |
| − | is "group". A "group" entry indicates the format to use for
| |
| − | a particular group of features.
| |
| − |
| |
| − | <p>
| |
| − | <dl>
| |
| − | | |
| − | <dt><TYPE> (required; one or more per CATEGORY)
| |
| − | <dd>There are one or more <TYPE> tags per <CATEGORY>,
| |
| − | each providing display suggestions for one type of annotation.
| |
| − | The <b>id</b> (required) uniquely identifies the type. A special
| |
| − | id is "default", which, if present, identifies a default style
| |
| − | for the enclosing category.
| |
| − | <p>
| |
| − | <dl>
| |
| − | <dt><GLYPH> (required; one or more per TYPE)
| |
| − | <dd>There is one or more <GLYPH> tag per <TYPE>. It provides
| |
| − | information on what glyph (graphical widget) to use to display
| |
| − | the indicated annotation type. The optional <b>zoom</b> attribute,
| |
| − | implements a simple form of semantic zooming, and allows the client
| |
| − | to select the glyph and its attributes based on the zoom level. Possible
| |
| − | values are "high", "medium" and "low". If multiple <GLYPH> tags
| |
| − | are present, this attribute <b>must</b> be present in order to select
| |
| − | among them. A "high" zoom means that there are fewer base pairs per
| |
| − | pixel (high magnification). A "low" zoom shows more base pairs. "Medium" is
| |
| − | intermediate. It is left to the client to
| |
| − | determine the boundaries for "high", "medium" and "low", since this is a
| |
| − | function of the graphics rendering.
| |
| − | <p>
| |
| − | | |
| − | <dl>
| |
| − | <dt><<i>ID</i>> (required; one per GLYPH)
| |
| − | <dd>The ID value refers to a recognized glyph from the glyph types
| |
| − | list (<a href="#glyphid" target="result">see below</a>).
| |
| − | <p>
| |
| − | <dt><<i>ATTR</i>> (optional; one or more per ID)
| |
| − | <dd>The recognized ATTR (attributes) are determined by which glyph
| |
| − | ID is specified. See the <a href="#glyphid">glyph types</a>
| |
| − | list below for more information.
| |
| − | </dl>
| |
| − | | |
| − | </dl>
| |
| − | </dl>
| |
| − | </dl>
| |
| − | <p>
| |
| − | Here is a short stylesheet example:
| |
| − | <pre>
| |
| − | ...
| |
| − | <CATEGORY id="Similarity">
| |
| − | <TYPE id="default">
| |
| − | <GLYPH>
| |
| − | | |
| − | <LINE>
| |
| − | <FGCOLOR>gray</FGCOLOR>
| |
| − | </LINE>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | | |
| − | <TYPE id="NN">
| |
| − | <GLYPH >
| |
| − | <BOX>
| |
| − | <HEIGHT>4</HEIGHT>
| |
| − | <FGCOLOR>black</FGCOLOR>
| |
| − | <BGCOLOR>red</BGCOLOR>
| |
| − | | |
| − | </BOX>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | <TYPE id="NP">
| |
| − | <GLYPH>
| |
| − | <TOOMANY>
| |
| − | | |
| − | <HEIGHT>4</HEIGHT>
| |
| − | <FGCOLOR>black</FGCOLOR>
| |
| − | <BGCOLOR>blue</BGCOLOR>
| |
| − | </TOOMANY>
| |
| − | | |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | <TYPE id="PN">
| |
| − | <GLYPH>
| |
| − | <BOX>
| |
| − | <HEIGHT>3</HEIGHT>
| |
| − | | |
| − | <FGCOLOR>blue</FGCOLOR>
| |
| − | <BGCOLOR>green</BGCOLOR>
| |
| − | </BOX>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | | |
| − | <TYPE id="PP">
| |
| − | <GLYPH>
| |
| − | <SPAN>
| |
| − | <HEIGHT>4</HEIGHT>
| |
| − | <FGCOLOR>gray</FGCOLOR>
| |
| − | | |
| − | </SPAN>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | </CATEGORY>
| |
| − | ...
| |
| − | </pre>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Groups can also have stylesheet entries. If present, they are located
| |
| − | in the category named "group". Typically a group will be associated
| |
| − | with the "line" glyph, which as described below, draws
| |
| − | connections between the members of a group.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | A sample stylesheet used for the WormBase DAS server can be found at
| |
| − | <a
| |
| − | href="sample_stylesheet.xml">http://www.biodas.org/documents/sample_stylesheet.xml</a>.
| |
| − | | |
| − | <h3>Glyphs and Groups</h3>
| |
| − | | |
| − | <p> Glyphs and their attributes are typically applied to individual
| |
| − | features. However, they can be applied to entire groups as well (via
| |
| − | the <GROUP> <b>type</b> attribute). In this case, the glyph
| |
| − | will apply to the connecting regions <b>between</b> the components of
| |
| − | the group. <p>
| |
| − | | |
| − | For example, to indicate that the exons in a "transcript" group should
| |
| − | be drawn with a yellow box, that the utrs should be drawn with a blue
| |
| − | box, and that the connections between exons should be drawn with a
| |
| − | hat-shaped line:
| |
| − | | |
| − | <pre>
| |
| − | <CATEGORY id="Transcription">
| |
| − | <TYPE id="exon">
| |
| − | <GLYPH>
| |
| − | <BOX>
| |
| − | <BGCOLOR>yellow</BGCOLOR>
| |
| − | | |
| − | </BOX>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | | |
| − | <TYPE id="utr">
| |
| − | <GLYPH>
| |
| − | <BOX>
| |
| − | | |
| − | <BGCOLOR>blue</BGCOLOR>
| |
| − | </BOX>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | </CATEGORY>
| |
| − | | |
| − | <CATEGORY id="group">
| |
| − | <TYPE id="transcript">
| |
| − | <GLYPH>
| |
| − | <LINE>
| |
| − | <FGCOLOR>black</FGCOLOR>
| |
| − | <LINE_STYLE>hat</LINE_STYLE>
| |
| − | | |
| − | </LINE>
| |
| − | </GLYPH>
| |
| − | </TYPE>
| |
| − | ...
| |
| − | </pre>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <font color="red"><h2><a name="assemblies">Fetching Sequence Assemblies has been deprecated due to a percieved lack of use - so this secion no longer exists</a></h2></font>
| |
| − | <hr>
| |
| − | | |
| − | | |
| − | <h2>Feature Types and Categories</h2>
| |
| − | <font color="red">Maybe useful to put SO equivalents for most of these examples???</font>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This is a list of generic feature categories and specific feature
| |
| − | types within them. This list was derived from the features currently
| |
| − | exported by ACeDB/GFF and is not comprehensive. Suggestions for
| |
| − | modifications, additions and deletions are welcomed.
| |
| − | | |
| − | <h3><cite>component</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This category indicates that the feature is a child component of the
| |
| − | reference sequence in the current assembly. When combined with the
| |
| − | <b>reference="yes"</b> attribute, this indicates that the feature can
| |
| − | be used as a reference point to retrieve subfeatures contained within
| |
| − | it (including subcomponents).
| |
| − | | |
| − | | |
| − | <h3><cite>supercomponent</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This category indicates that the feature is the parent of the
| |
| − | reference sequence in the current assembly. When combined with the
| |
| − | <b>reference="yes"</b> attribute, this indicates that the feature can
| |
| − | be used as a reference point to retrieve features that completely
| |
| − | contain the selected range of the reference sequence.
| |
| − | | |
| − | <h3><cite>translation</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>translation</cite> category is used for features that relate
| |
| − | to regions of the sequence that are translated into proteins.
| |
| − | Features that relate to transcription are separate (see below).
| |
| − | | |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − |
| |
| − | <ul>
| |
| − | <li>stop - position of the translation stop codon
| |
| − | <li>ATG - position of the start codon
| |
| − | <li>CDS - position of the coding region
| |
| − | <li>5'UTR - untranslated region
| |
| − | <li>3'UTR - untranslated region
| |
| − | <li>misc_translated - miscellaneous
| |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the transcription feature.
| |
| − | | |
| − | | |
| − | <h3><cite>transcription</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>transcription</cite> category is used for features that relate
| |
| − | to regions of the sequence that are transcribed into RNA.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>exon
| |
| − | <li>intron
| |
| − | <li>tRNA
| |
| − | <li>mRNA
| |
| − | <li>ncRNA
| |
| − | <li>5'Cap - transcriptional start site
| |
| − | <li>PolyA
| |
| − | <li>Splice5 - splice donor
| |
| − | <li>Splice3 - splice acceptor
| |
| − | <li>misc_transcribed
| |
| − | | |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the transcription feature.
| |
| − | | |
| − | <h3><cite>variation</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>variation</cite> category is used for features that relate
| |
| − | to regions of the sequence that are polymorphic.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>insertion
| |
| − | <li>deletion
| |
| − | <li>substitution
| |
| − | <li>misc_variation
| |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the variation.
| |
| − | | |
| − | <h3><cite>structural</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>structural</cite> category is used for features that relate
| |
| − | to mapping, sequencing and assembly, as well as for various landmarks
| |
| − | that carry no intrinsic biological information.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>clone
| |
| − | <li>primer_left
| |
| − | <li>primer_right
| |
| − | <li>oligo
| |
| − | <li>assembly_tag
| |
| − | <li>misc_structural
| |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the structural feature.
| |
| − | | |
| − | <h3><cite>similarity</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>similarity</cite> category is used for areas that are
| |
| − | similar to other sequences. Similarity features should have a
| |
| − | <METHOD> tag that indicates the algorithm used for the sequence
| |
| − | comparison, and a <TARGET> tag that indicates the target of the
| |
| − | match.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>NN -- nucleotide to nucleotide similarity (e.g. blastn)
| |
| − | <li>NP -- nucleotide to protein similarity (e.g. blastx)
| |
| − | <li>PN -- protein to nucleotide similarity (e.g. tblastn)
| |
| − | <li>PP -- protein to protein similarity (e.g. tblastx)
| |
| − | <li>misc_homology
| |
| − | | |
| − | </ul>
| |
| − | | |
| − | <h3><cite>repeat</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>repeat</cite> category is used for areas that contain
| |
| − | repetitive DNA. This category is used both for low-complexity
| |
| − | regions, such as microsatellites, and for more biologically
| |
| − | interesting features, such as transposon insertion sites.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>microsatellite
| |
| − | <li>inverted
| |
| − | <li>tandem
| |
| − | <li>transposable_element
| |
| − | <li>LINE - long repeat not definitely identified as a transposon
| |
| − | <li>misc_repeat
| |
| − | | |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the repetitive element.
| |
| − | | |
| − | <h3><cite>experimental</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The <cite>experimental</cite> category is a catchall used to flag
| |
| − | areas where there is interesting experimental data of one sort or
| |
| − | another. It is intended for use with high-throughput functional
| |
| − | genomics work, such as knockouts or insertional mutagenesis screens.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Features:
| |
| − | | |
| − | <ul>
| |
| − | <li>knockout
| |
| − | <li>expression_tag
| |
| − | <li>microarrayed
| |
| − | <li>RNAi_result
| |
| − | <li>transgenic
| |
| − | <li>mutant - a mutant phenotype associated with region
| |
| − | <li>misc_experimental
| |
| − | | |
| − | </ul>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | It is recommended, but not required, that the <FEATURE> section
| |
| − | contain <LINK> and/or <NOTE> tags that provide further
| |
| − | information on the nature of the experimental data.
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <a name="glyphid">
| |
| − | | |
| − | <h2>Glyph Types</h2>
| |
| − | | |
| − | <p>
| |
| − | This section describes a set of generic "glyphs" that can be used by
| |
| − | sequence display programs to display the position of features on a
| |
| − | sequence map. The annotation server may use these glyphs to send
| |
| − | display suggestions to the viewer via the <a
| |
| − | href="#stylesheet">stylesheet document</a>.
| |
| − | | |
| − | <p> The current set of glyph ID values are:
| |
| − | <ul>
| |
| − | <li> ARROW
| |
| − | <li> ANCHORED_ARROW
| |
| − | <li> BOX
| |
| − | <li> CROSS
| |
| − | | |
| − | <li> EX
| |
| − | <li> HIDDEN
| |
| − | <li> LINE
| |
| − | <li> SPAN
| |
| − | <li> TEXT
| |
| − | <li> TOOMANY
| |
| − | <li> TRIANGLE
| |
| − | <li> PRIMERS
| |
| − | </ul>
| |
| − | | |
| − | <p>Each glyph has a set of attributes associated with it. Attribute
| |
| − | values come in the following flavors:
| |
| − | | |
| − | <dl>
| |
| − | <dt>INT
| |
| − | <dd>An integer
| |
| − | <dt>FLOAT
| |
| − | <dd>A floating point number (not currently used)
| |
| − | <dt>STRING
| |
| − | <dd>A text string
| |
| − | <dt>COLOR
| |
| − | <dd>A color. Colors can be specified using the "#RRGGBB" format
| |
| − | commonly used in HTML, or as one of the 16 IBM VGA colors
| |
| − | recognized by Netscape and Internet Explorer.
| |
| − | <dt>BOOL
| |
| − | <dd>A boolean value, either "yes" or "no".
| |
| − | <dt> FONT
| |
| − | <dd>A font. Any of the font identifiers recognized by Web browsers
| |
| − | is acceptable, e.g. "helvetica".
| |
| − | <dt>FONT_STYLE
| |
| − | <dd>One of "bold", "italic", "underline".
| |
| − | <dt>LINE_STYLE
| |
| − | <dd> One of "hat", "solid", "dashed".
| |
| − | | |
| − | </dl>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Some attributes are shared by all glyphs. Others are glyph-specific.
| |
| − | The following attributes are shared in common:
| |
| − | | |
| − | <dl>
| |
| − | <dt>HEIGHT
| |
| − | <dd>type: INT
| |
| − | <dd>The height of the glyph, in pixels. For the text font, this is
| |
| − | equivalent to the FONTSIZE attribute.
| |
| − | <dt>FGCOLOR
| |
| − | <dd>type: COLOR
| |
| − | <dd>The foreground color of the glyph. This is the line and outline color for graphical
| |
| − | glyphs, and the font color for text glyphs.
| |
| − | <dt>BGCOLOR
| |
| − | <dd>type: COLOR
| |
| − | <dd>The background color of the glyph. For hollow glyphs, such as boxes, this is the color
| |
| − | of the interior of the box. For solid glyphs, such as text, this is ignored
| |
| − | <dt>LABEL
| |
| − | <dd>BOOL
| |
| − | <dd>Whether the glyph should be labeled with its name, as dictated
| |
| − | by the <FEATURE> <b>label</b> attribute in the DASGFF document.
| |
| − | <dt>BUMP
| |
| − | <dd>BOOL
| |
| − | <dd>Whether the glyph should "bump" intersecting glyphs so that they
| |
| − | do not overlap.
| |
| − | | |
| − | </dl>
| |
| − | | |
| − | <h3><cite>ARROW</cite></h3>
| |
| − | | |
| − | A double-headed arrow with an axis either orthogonal or parallel to
| |
| − | the sequence map.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>PARALLEL
| |
| − | <dd>type: BOOL
| |
| − | <dd>Arrows run either parallel ("yes") or orthogonal("no") to the
| |
| − | sequence axis.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>ANCHORED_ARROW</cite></h3>
| |
| − | | |
| − | An arrow that has an arrowhead at one end, and an "anchor" (typically
| |
| − | a diamond or line) at the other. The arrow points in the direction
| |
| − | indicated by the <ORIENTATION> tag.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>PARALLEL
| |
| − | <dd>type: BOOL
| |
| − | <dd>Arrows run either parallel ("yes") or orthogonal("no") to the
| |
| − | sequence axis.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>BOX</cite></h3>
| |
| − | | |
| − | A rectangular box.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>LINEWIDTH
| |
| − | <dd>type: INT
| |
| − | <dd>Width of the box outline.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>CROSS</cite></h3>
| |
| − | | |
| − | A cross "+". Common used for point mutations and other point-like
| |
| − | features.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <p>
| |
| − | (no glyph-specific attributes)
| |
| − | | |
| − | <h3><cite>DOT</cite></h3>
| |
| − | | |
| − | A dot. Common used for point mutations and other point-like features.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <p>
| |
| − | | |
| − | (no glyph-specific attributes)
| |
| − | | |
| − | <h3><cite>EX</cite></h3>
| |
| − | | |
| − | "X" marks the spot. Common used for point mutations and other
| |
| − | point-like features.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <p>
| |
| − | | |
| − | (no glyph-specific attributes)
| |
| − | | |
| − | <h3><cite>HIDDEN</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | A feature that is invisible, intended to support semantic zooming
| |
| − | schemes in which a feature is hidden at particular zooms.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes: none.
| |
| − | | |
| − | <h3><cite>LINE</cite></h3>
| |
| − | | |
| − | A line. Lines are equivalent to arrows with both the
| |
| − | <cite>northeast</cite> and <cite>southwest</cite> attributes set to "no".
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>STYLE
| |
| − | <dd>type: LINE_STYLE
| |
| − | <dd>The line type. A type of "hat" draws an inverted V
| |
| − | (commonly used for introns). A type of "solid"
| |
| − | draws a horizontal solid line in the indicated color. A type of
| |
| − | "dashed" draws a dashed horizonal line in the indicated color.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>SPAN</cite></h3>
| |
| − | | |
| − | A spanning region, the recommended representation is a horizontal
| |
| − | line with vertical lines at each end.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <p>
| |
| − | | |
| − | (no glyph-specific attributes)
| |
| − | | |
| − | <h3><cite>TEXT</cite></h3>
| |
| − | | |
| − | A bit of text.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>FONT
| |
| − | <dd>type: FONT
| |
| − | <dd>The font.
| |
| − | <dt>FONTSIZE
| |
| − | <dd>type: INT
| |
| − | <dd>The font size.
| |
| − | <dt>STRING
| |
| − | <dd>type: STRING
| |
| − | <dd>The text to render.
| |
| − | <dt>STYLE
| |
| − | <dd>type: FONT_SYTLE
| |
| − | <dd>The style in which to render this glyph. Multiple FONT_STYLE
| |
| − | attributes may be present.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>PRIMERS</cite></h3>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Two inward-pointing arrows connected by a line of a different color.
| |
| − | Used for showing primer pairs and a PCR product. The length of the
| |
| − | arrows is meaningless.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | There are no glyph-specific attributes, but in this context the
| |
| − | foreground color is the color of the arrows, and the background color
| |
| − | is the color of the line that connects them.
| |
| − | | |
| − | <h3><cite>TOOMANY</cite></h3>
| |
| − | | |
| − | Too many features than can be shown. Recommended for use in
| |
| − | consolidating sequence homology hits. The recommended visual
| |
| − | presentation is a set of overlapping boxes.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | | |
| − | <dt>LINEWIDTH
| |
| − | <dd>type: INT
| |
| − | <dd>Width of the glyph.
| |
| − | </dl>
| |
| − | | |
| − | <h3><cite>TRIANGLE</cite></h3>
| |
| − | | |
| − | A triangle. Commonly used for point mutations and other point-like
| |
| − | features. The triangle is always drawn in the center of its range,
| |
| − | but its width and height can be controlled by HEIGHT and LINEWIDTH
| |
| − | respectively.
| |
| − | | |
| − | <p>
| |
| − | | |
| − | Attributes:
| |
| − | | |
| − | <dl>
| |
| − | <dt>LINEWIDTH
| |
| − | <dd>type: INT
| |
| − | <dd>Width of the glyph.
| |
| − | <p>
| |
| − | | |
| − | <dt>DIRECTION
| |
| − | <dd>One of "N", "E", "S", and "W"
| |
| − | </dl>
| |
| − | | |
| − | <hr>
| |
| − | | |
| − | <h2>Other Issues</h2>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | The distributed annotation system must have a mechanism for detecting
| |
| − | and resolving version skew across reference and annotation servers.
| |
| − | Although one such mechanism is currently incorporated into the
| |
| − | ACeDB-based prototype, it is largely untested and hence not yet a part
| |
| − | of the DAS standard.
| |
| − | | |
| − | <h2><a name="changes">Changes</a></h2>
| |
| − | | |
| − | <p>
| |
| − | | |
| − | This section was added at version 0.99.
| |
| − | | |
| − | <h3>Version 1.51</h3>
| |
| − | <ol>
| |
| − | <li>The description of the entry_points document was out of synch
| |
| − | with the DTD. Also there seems to have been some semantic drift between
| |
| − | Dazzle, the UCSC server, and LDAS with regards to the attributes of the
| |
| − | <SEGMENT> tag. This has now been made explicit, and the DTD relaxed
| |
| − | to allow all styles.
| |
| − | </ol>
| |
| − | | |
| − | <h3>Version 1.5</h3>
| |
| − | <ol>
| |
| − | <li>Added capabilities header.
| |
| − | <li>Added exception handling for invalid sequence IDs.
| |
| − | <li>Added feature_id request.
| |
| − | <li>Corrected syntax errors in stylesheet example.
| |
| − | | |
| − | </ol>
| |
| − | | |
| − | <h3>Version 1.01</h3>
| |
| − | <ol>
| |
| − | <li>Split assembly functionality into "component" and "supercomponent".
| |
| − | <li>Removed redundant descriptions of glyph attributes.
| |
| − | </ol>
| |
| − | | |
| − | <h3>Version 1.0</h3>
| |
| − | <ol>
| |
| − | <li>Removed deprecated <i>resolve</i> command.
| |
| − | <li>Removed deprecated <i>entry_points</i> <b>ref</b> argument.
| |
| − | <li>Added <b>superparts</b> attribute to DASGFF <FEATURE> tag.
| |
| − | <li>New discussion of how to move upwards in an assembly.
| |
| − | <li>Reorganized specification to put responses close to requests.
| |
| − | <li>Added a stylesheet example document.
| |
| − | <li>Normalized the names of glyph COLOR and FILLCOLOR attributes to
| |
| − | FGCOLOR and BGCOLOR.
| |
| − | <li>Added the LABEL attribute to all glyphs.
| |
| − | <li>Added the STYLE attribute to the LINE glyph.
| |
| − | <li>Added the ability to assign a glyph to a group.
| |
| − | <li>Added HIDDEN glyph.
| |
| − | | |
| − | </ol>
| |
| − | | |
| − | <h3>Version 0.999</h3>
| |
| − | <ol>
| |
| − | <li>Added LINK, NOTE, and TARGET to FEATURE
| |
| − | <li>Added section entitled "Fetching Sequence Assemblies"
| |
| − | </ol>
| |
| − | | |
| − | <h3>Version 0.998</h3>
| |
| − | <ol>
| |
| − | <li> Deprecated regular expression matching for types and categories.
| |
| − | <li> Allow multiple TYPE arguments for logical OR filtering.
| |
| − | <li> Made FEATURE optional within features return document.
| |
| − | <li> Made TYPE optional within types return document.
| |
| − | | |
| − | </ol>
| |
| − | <h3>Version 0.996</h3>
| |
| − | <ol>
| |
| − | <li>Added subparts tag to features and entry_points.
| |
| − | <li>Removed the requirement that the server return features that
| |
| − | do not overlap with the requested segment.
| |
| − | <li>Added support for multiple segments/sequences in types document.
| |
| − | </ol>
| |
| − | | |
| − | <h3>Version 0.995</h3>
| |
| − | <ol>
| |
| − | <li>Added support for multiple segments/sequences in returned documents.
| |
| − | <li>Added support for assembly components.
| |
| − | </ol>
| |
| − | | |
| − | <h3>Version 0.99</h3>
| |
| − | | |
| − | <ol>
| |
| − | <li>Allow query parameters to be POSTed to the DAS URL.
| |
| − | <li>Added compatibility warning about SOAP conversion.
| |
| − | <li>Use Version 8 regular expressions rather than GNU's, giving
| |
| − | compatibility with both Perl regex and GNU regex.
| |
| − | <li>Made the <b>id</b> attribute of the <TYPE> tag required.
| |
| − | <li>Changed the WIDTH glyph attribute to HEIGHT throughout.
| |
| − | | |
| − | </ol>
| |
| − | | |
| − | <hr>
| |
| − | <address>Lincoln D. Stein, lstein@cshl.org<br>
| |
| − | <a href="http://www.cshl.org/">Cold Spring Harbor Laboratory</a></address>
| |
| − | <!-- hhmts start -->
| |
| − | Last modified: Thu May 22 12:55:39 EDT 2003
| |
| − | <!-- hhmts end -->
| |
| − | <p>
| |
