Difference between revisions of "Spec Review"

From BioDAS
Jump to: navigation, search
(Fetching Sequence Assemblies)
(Response:)
 
(128 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
'''Oct 1,2008'''
 
'''Oct 1,2008'''
  
This is a working document and a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the <a href="http://www.dasregistry.org/spec_1.53E.jsp">1.53E spec</a> and some of the 2.0 spec. Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as alignments and protein structures. The spec also includes references to the DAS Registry which is essential for implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures.
+
This is a working document and a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the [http://www.dasregistry.org/spec_1.53E.jsp 1.53E spec] and some of the 2.0 spec. Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as protein sequences and structures. The spec also includes references to the DAS Registry which is essential for implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures.
 +
<font color="red">Note that we are proposing to change dtd for xsd</font>
  
==Overview of the System==
+
==System Architecture==
  
This section provides a high-level view of the system architecture.
+
The Distributed Annotation System is a network of server and client software installations distributed across the web. The DAS protocol is a standard mechanism through which clients can communicate with servers in order to obtain various types of biological data. The protocol defines:
 +
* the communication method
 +
* the query model
 +
* the data format
 +
By enforcing these constraints, DAS allows a client to integrate data from many diverse sources implementing the protocol at a scaleable development cost.
  
===System Components (Co-ordinate System Servers, Annotation Servers and the DAS Registry)===
+
The DAS network of servers comprises a ''registry'', several ''reference servers'' and several ''annotation servers''. Tying these together are the concepts of ''reference objects'' and ''coordinate systems''.
The DAS system consists of the a reference server, one or more annotation servers and the das registry.
 
  
====The Reference Server====
+
===Reference Objects===
  
Central to the DAS system is the idea of reference objects that can be served from a reference server.
+
Reference objects are items of data with stable identifiers that are targets for annotation. At the most abstract level a reference object might be an annotatable concept or idea (e.g. a particular gene), but usually describes a biological unit within which annotations can be positioned. For example, "P15056" refers to a protein sequence upon which annotations can be based. Similarly, "chromosome 21" refers to a DNA sequence.
These are biological data objects with stable identifiers which are targets for annotation. In the original DAS protocol, the reference objects are always biological sequences: chromosomes, scaffold sequences from genome assemblies or protein sequences. When a DAS client starts, its first action is to connect to an appropriate reference server and retrieve the reference sequence. Once a reference object has been loaded, the DAS client will contact one or more annotation servers to obtain the data provided for the reference objects. Typical annotations might include sets of predicted exons on a genome sequence, or matches to a protein domain model on a protein sequence. It is the client's responsibility to collect all relevant annotations and display them in a user-friendly manner.
 
<p> A coordinate system describes the data that is made available by a DAS source/reference server. This information is important for the DAS clients, to deal with data correctly, as they often can accept data served in multiple coordinate systems.
 
The coordinate systems are described by four fields: Authority, (assembly) Version, Type, and Organism. The assembly version is important for genome assemblies, but not really applicable for other datasets like UniProt sequences, therefore this field is optional.
 
</p>
 
  
====Annotation Server====
+
Individual reference objects can in fact have several versions, and it is important to recognise that annotations based upon different versions of the same reference entity are not necessarily equivalent.
  
Annotation servers are specialized for returning lists of annotations
+
===Annotations===
across a reference object served by the reference server.  Each annotation can be anchored to
 
the co-ordinate system map by way of a start and stop position relative to one of
 
the reference objects.Annotations have an ID that is unique to
 
the server and a structured description that describes its nature and
 
attributes.  Annotations may also be associated with Web URLs that
 
provide additional human readable information about the annotation.
 
  
<p>
+
Annotations are pieces of information that are always attributed to a reference object. Annotations are usually ''positional'', that is they refer to a specific location within a reference object. An exon within a genomic sequence is an example. Annotations can also be ''non-positional'', in which case they can be considered as information attributed to the whole of the reference object. For example, the description of a protein or gene.
  
Annotations have <i>types</i>, <i>methods</i> and <i>categories</i>.
+
===Coordinate Systems===
The annotation <b>type</b> is selected from a list of types that have
 
biological significance <font color="red"> though these do not help the readability of xml returned so I can see why people are reluctant to adapt them</font>),
 
<font color="red">delete this EMBL bit?</font> and correspond roughly to EMBL/GenBank
 
feature table tags.  Examples of annotation types include "exon",
 
"intron", "CDS" and "splice3."(We encourage the use of the <a href="http://www.sequenceontology.org/">Sequence Ontology</a>
 
<font color="blue">Tip: We recommend OboEdit for looking up ontologies for regular use and the ontologies it uses can be downloaded from <a href="http://www.berkeleybop.org/ontologies/#ontologies">here</a></font>
 
IDs to give uniformity to DAS sources for example CDS is SO:0000316 <font color="red"> is there a better resource out there that you can go from id to name and desciption and visa versa??</font>).  The annotation <b>method</b> is
 
intended to describe how the annotated feature was discovered, and may
 
include a reference to a software program (we also encourage the use of ECO numbers to represent the method of annotation e.g.ECO:0000032 "inferred from curated blast match to nucleic acid).  The annotation
 
  
<a href="http://www.ebi.ac.uk/ontology-lookup/">
+
A coordinate system is a stable, logical set of reference objects. A coordinate system provides a mechanism to uniquely identify reference objects that share identifiers, such as chromosomes. For example, chromosome 21 might identify several reference objects from different species', but only one within the NCBI 36 human assembly. Thus, "human NCBI 36 chromosomes" is a coordinate system containing 25 reference objects.
  
 +
Coordinate systems are formally described using four properties:
 +
* The '''category''' or type of annotatable entity. For example a chromosome, contig or protein sequence
 +
* The '''authority''' responsible for defining the coordinate system. For example NCBI or UniProt
 +
* The '''version''', for coordinate systems containing entities that are not versioned (e.g. genomic assemblies)
 +
* The '''species''', for coordinate systems containing only entities from a single organism
 +
Of these, category and authority are required.
  
<b>category</b> is a broad functional category that can be used to
+
Some example coordinate systems:
filter, group and sort annotations.  "Homology", "variation" and
 
"transcribed" are all valid categories.  The existence of these
 
categories allows researchers to add new annotation types if the
 
existing list is inadequate without entirely losing all semantic
 
value.  The <a href="#categories">Annotation Categories</a> section
 
contains a list of the annotation types in use in the
 
<cite>C. elegans</cite> project.
 
  
<p>
+
{| border="border"
 
+
|-
It is intended that larger annotation servers provide pointers to
+
! Category
human-readable data that describes its types, methods and categories
+
! Authority
in more detail.  Another optional feature of annotation servers is the
+
! Version
ability to provide hints to clients on how the annotations should be
+
! Species
rendered visually.  This is done by returning a XML "stylesheet".
+
|-
 
+
| Chromosome
<p>
+
| NCBI
 +
| 36
 +
| Homo sapiens
 +
|-
 +
| Scaffold
 +
| ZFISH
 +
| 7
 +
| Danio rerio
 +
|-
 +
| Protein sequence
 +
| UniProt
 +
| -
 +
| -
 +
|}
  
The co-ordinate system server is an annotation server that provides
+
===Reference & Annotation Servers===
the following additional services:
 
  
<ol>
+
A reference server is a DAS server that provides core data for the reference objects in a particular coordinate system. For example, the reference server for "UniProt Protein sequence" provides the actual sequence for each UniProt entry. It does this by implementing the DAS ''sequence'' command. So that clients can discover the available reference objects in a coordinate system, a reference server must also list them via the ''entry_points'' command.
  <li>Given a reference sequence id, it can return the raw DNA of that sequence.
 
  <li>Given a reference sequence id, it can return annotations of the
 
      category "component".  Component annotations describe how the
 
      sequence is assembled from smaller parts into large parts from the
 
      top down.
 
  <li><font color="red">deprecate this?</font>Given a reference sequence id, it can return annotations of the
 
      category "supercomponent".  Component parent annotations
 
      describe the assembly of the sequence from the bottom up.
 
  
</ol>
+
Annotation servers are specialized for returning lists of annotations for the reference objects within a coordinate system. This is done by implementing the DAS ''features'' command.
  
<p>
+
<font color="blue">In future versions of the spec (i.e. those not focussed entirely on sequence) this will be generalised. That is, reference objects won't be assumed to be sequences and annotations won't be assumed to be sequence features.</font>
  
Although the servers are conceptually divided between reference
+
'''Note:''' The distinction between reference and annotation servers is conceptual rather than physical. That is, a single server instance can in fact play both roles by offering both sequences and annotations of those sequences.
servers and annotation servers, there is in fact no key difference
 
between them. A single server can provide both reference sequence
 
information and annotation information.  The main functional
 
difference is that the reference sequence server is required to serve
 
the sequence map and the raw DNA, while annotation servers have no
 
such requirement <font color="red">how to generalise this? What does not serve sequence info?</font>.
 
  
<p>
+
'''Note:''' A server may support multiple coordinate systems.
  
====The DAS Registry====
+
===The DAS Registry===
central DAS registry which implements this protocol and fulfils the following roles:
 
  
1. It allows discovery of available DAS sources via a web page, or as machine-readable XML which can be used directly by DAS client programs.
+
The DAS registry is a special component of DAS, fulfilling the following roles:
  
2. It automatically validates registered DAS sources to ensure that they return well formed DAS XML.
+
# Catalogues and describes the capabilities and coordinate systems of DAS services
 +
# Allows discovery of available DAS services via both human and programmatic interfaces
 +
# Automatically validates registered DAS sources to ensure that they correctly implement the protocol
 +
# Periodically tests DAS sources and notifies their administrators if they are unavailable
 +
# Provides a mechanism for activating or highlighting individual DAS services in clients
  
3. It periodically tests DAS sources and notifies their administrators if they are unavailable.
+
<font color="red"> a list of cmds that you can perform on the registry such as /das1/sources and http://www.dasregistry.org/das/coordinatesystem can be found here http://www.dasregistry.org/help_scripting.jsp#coordinatesystem </font>
  
4. It can group the registered DAS sources according to the coordinate systems of their data.
+
===Clients===
  
5. It can also communicate bi-directionally with DAS clients and activate or highlight DAS sources in clients.
+
A DAS client typically integrates data from a number of DAS servers, making use of the different data types. For example, a client might implement the following procedure for a particular sequence location:
</p>
 
  
====The Co-ordinate System====
+
# Contact DAS registry to find reference and annotation servers for a particular genomic assembly
The distributed annotation system (DAS) relies on there being a common
+
# Obtain sequence from the reference server
"co-ordinate system" on which to base annotations.  The co-ordinate system consists of a set of "entry points", and
+
# Obtain sequence features from each of the annotation servers
the lengths of each entry point <font color="red">but not all in the case of alignments??</font>.  The identity of an entry point will
+
# Display the annotations in the context of the sequence
vary from co-ordinate system to co-ordinate system.  For some projects, entry points
 
correspond to entire chromosomes.  For others, entry points may be a
 
series of contigs or proteins.
 
  
<p>
+
See this example in diagrammatic form: [[Media:Canonical_DAS_diagram_all.png|PNG image]]
 
 
The entry points describe the top level items on the co-ordinate system. 
 
<font color="red">remove this section on subsequence?</font>It is possible for each entry point to have substructure, basically
 
a series of subsequences (components) and their start and end points.  This
 
structure is recursive.  Each annotation is unambiguously located by providing
 
its position as the start and stop positions relative to a "reference object." 
 
The reference object can be one of the entry points, or any of the
 
subsequences within the entry point.<br/>
 
  
 
==Client/Server Interactions==
 
==Client/Server Interactions==
  
The DAS is Web-based. Clients query the reference and annotation servers by sending a formatted URL request to the server. This request must follow the conventions of the HTTP/1.0 protocol (see [ftp://ftp.isi.edu/in-notes/rfc2616.txt RFC2616]. Servers process the request and return a response in the form of a formatted XML document (see [http://www.w3.org/XML/ W3C Extensible Markup Language]).
+
The DAS is web-based. Clients query the reference and annotation servers using the HTTP protocol (see [ftp://ftp.isi.edu/in-notes/rfc2616.txt RFC2616]) by sending a formatted URL request to the server. Servers process the request and return a response in the form of a formatted XML document (see [http://www.w3.org/XML/ W3C Extensible Markup Language]) according to a predefined schema.
  
 
===The Request===
 
===The Request===
  
All DAS requests take the form of a URL. Each URL has a site-specific prefix, followed by a standardized path and query string. The standardized path begins with the string '''/das'''. This is followed by URL components containing the data source name and a command. For example:
+
All DAS requests take the form of a hierarchical URL. Each URL has a site-specific prefix, followed by a standardized path and query string. The standardized path begins with the string '''/das'''. This is followed by URL components containing the data source name and a command.<font color="red"> Should put some guidance or specify the ability for servers to accept encoded URLs</font> For example:
 
+
<font color="red">How do we get everyone to specify say "chromosome1" in the exact same way not "chr1" etc. </font><font color="blue">By coordinate system and entry_points I guess. Reference server MUST implement entry_points, regardless of number of objects (don't expect it to come back quickly). We can always add a "range" parameter later</font>
 
<code>
 
<code>
  
 
   
 
   
  http://www.wormbase.org/db/das/elegans/features?segment=CHROMOSOME_I:1000,2000
+
  http://das.sanger.ac.uk/das/ccds_mouse/features?segment=1:174405453,174408689
  ^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
+
  ^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
    site-specific prefix   das  data  command  arguments
+
  site-specific prefix <font color="red">das</font> <font color="blue">data src</font>  <font color="green">command</font>   <font color="orange">arguments</font>
                                  src
 
  
 
</code>
 
</code>
  
In this case, the site-specific prefix is '''http://www.wormbase.org/db'''. The request begins with the standardized path '''/das''', and the data source, in this case '''/elegans'''. This is followed by the command '''/features''', which requests a list of features, and a query string providing named arguments to the '''/features''' command.
+
In this case, the site-specific prefix is '''http://das.sanger.ac.uk'''. The request begins with the standardized path '''/das''', and the data source, in this case '''/ccds_mouse'''. This is followed by the command '''/features''', which requests a list of features, and a query string providing named arguments to the '''/features''' command.
  
The data source component allows a single server to provide information on several genomes.
+
Thus, a single DAS server hosts one or more DAS ''sources'', allowing it to provide different types of information, and/or information in several coordinate systems. This example source provides consensus CDS transcripts for mouse chromosomes, but the same server provides a number of other sources, including a similar source for human along with sources containing very different types of data.
  
 
More information on the format of the request and the various available commands is given [#commands below].
 
More information on the format of the request and the various available commands is given [#commands below].
Line 152: Line 124:
 
The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.
 
The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.
  
'''<font color="red">Warning:</font>''' The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.
+
'''<font color="blue">DELETE: The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.</font>
  
 
===The Response===
 
===The Response===
  
The response from the server to the client consists of a standard HTTP header with DAS status information within that header followed optionally by an XML file that contains the answer to the query. The DAS status portion of the header consists of two lines. The first is X-DAS-Version and gives the current protocol version number, currently DAS/1.0. The second line is X-DAS-Status and contains a three digit status code which indicates the outcome of the request.
+
The response from the server to the client consists of a standard HTTP header with DAS status information within that header, followed optionally by XML content that contains the answer to the query. The DAS status portion of the header consists of <font color="blue">three</font> lines. The first is X-DAS-Version and gives the current protocol version number, currently <font color="blue">DAS/1.6</font>. The second line is X-DAS-Status and contains a three digit status code which indicates the outcome of the request. The third is X-DAS-Capabilities, which describes the parts of of the spec the server implements.
  
 
Here is an example HTTP header: (''provided by Web server'')
 
Here is an example HTTP header: (''provided by Web server'')
Line 169: Line 141:
 
  Connection: close                             
 
  Connection: close                             
 
  Content-Type: text/plain                     
 
  Content-Type: text/plain                     
  X-DAS-Version: DAS/1.5
+
  X-DAS-Version: <font color="blue">DAS/1.6</font>
 
  X-DAS-Status: 200
 
  X-DAS-Status: 200
 
  X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
 
  X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
Line 211: Line 183:
 
The HTTP/1.0 protocol allows web clients to request byte-level compression of the response by sending the HTTP header ''Accept-Encoding'' header. Web servers that are capable of it can reply with a ''Content-transfer-encoding'' header and a compressed body. Implementors of DAS clients and servers may wish to implement this HTTP feature.
 
The HTTP/1.0 protocol allows web clients to request byte-level compression of the response by sending the HTTP header ''Accept-Encoding'' header. Web servers that are capable of it can reply with a ''Content-transfer-encoding'' header and a compressed body. Implementors of DAS clients and servers may wish to implement this HTTP feature.
  
===New in version 1.5===
+
====X-DAS-Capabilities====
  
The X-Das-Capabilities header provides an extensible list of the capabilities that the server provides. This can be used by those writing experimental extensions to DAS to flag clients that those extensions are available. Capabilities have the form ''CapabilityName/Version'' and are separated by semicolon, space, as in "capabilityA/1.0; capabilityB/1.4; capabilityC/1.0". The following standard capabilities are present in the DAS/1.5 protocol:
+
The X-Das-Capabilities header provides an extensible list of the capabilities that the server provides. This can be used by <font color="blue">clients wishing to make use of optional components of the DAS protocol where they are supported, and by</font> those writing experimental extensions to DAS to flag clients that those extensions are available. Capabilities have the form ''CapabilityName/Version'' and are separated by semicolon, space, as in "capabilityA/1.0; capabilityB/1.4; capabilityC/1.0". The following standard capabilities are present in the DAS/1.6 protocol:
  
 
{| border="1" bgcolor="#DEB887"
 
{| border="1" bgcolor="#DEB887"
Line 221: Line 193:
 
|-
 
|-
 
! align="LEFT" | dsn/1.0
 
! align="LEFT" | dsn/1.0
| The server supports the basic ''dsn'' request.
+
| <font color="red">Deprecate these: The server supports the '''deprecated''' ''dsn'' request.</font>
 
|-
 
|-
 
! align="LEFT" | dna/1.0
 
! align="LEFT" | dna/1.0
| The server supports the basic ''dna'' request.
+
| <font color="red">The server supports the '''deprecated''' ''dna'' request.</font>
 
|-
 
|-
 
! align="LEFT" | types/1.0
 
! align="LEFT" | types/1.0
 
| The server supports the basic ''types'' request.
 
| The server supports the basic ''types'' request.
 
|-
 
|-
! align="LEFT" | stylesheet/1.0
+
! align="LEFT" | stylesheet/<font color="blue">1.1</font>
 
| The server supports the basic ''stylesheet'' request.
 
| The server supports the basic ''stylesheet'' request.
 
|-
 
|-
Line 248: Line 220:
 
|-
 
|-
 
! align="LEFT" | feature-by-id/1.0
 
! align="LEFT" | feature-by-id/1.0
| The ''features'' request will accept the CGI parameter "feature_id", enabling the server to look up segment(s) based on the ID of a feature.
+
| The ''features'' request will accept the CGI parameter "feature_id", enabling the server to look up <font color="blue">annotations</font> based on their ID.
 
|-
 
|-
 
! align="LEFT" | group-by-id/1.0
 
! align="LEFT" | group-by-id/1.0
| The ''features'' request will accept the CGI parameter "group_id", enabling the server to look up segment(s) based on the ID of a group.
+
| The ''features'' request will accept the CGI parameter "group_id", enabling the server to look up <font color="blue">annotations</font> based on the ID of a group.
 
|-
 
|-
 
! align="LEFT" | component/1.0
 
! align="LEFT" | component/1.0
| The ''features'' request will return components of the indicated segment when a category type of "component" is requested.
+
| <font color="blue">Deprecate?</font> The ''features'' request will return components of the indicated segment when a category type of "component" is requested.
 
|-
 
|-
 
! align="LEFT" | supercomponent/1.0
 
! align="LEFT" | supercomponent/1.0
| The ''features'' request will return supercomponents of the indicated segment when a category type of "supercomponent" is requested.
+
| <font color="blue">Deprecate?</font> The ''features'' request will return supercomponents of the indicated segment when a category type of "supercomponent" is requested.
 
|-
 
|-
 
! align="LEFT" | sequence/1.0
 
! align="LEFT" | sequence/1.0
| The server supports the new ''sequence'' request.
+
| The server supports the ''sequence'' request.
 
|}
 
|}
  
 
----
 
----
  
==Reference sequence IDs==
+
==Reference <font color="blue">Object</font> IDs==
 
 
Reference sequence IDs indicate a segment of the genome. They can correspond to low-level primary sequences such as sequenced clones, or to higher-level assemblies such as contigs.
 
  
A reference ID can contain any set of printable characters (including the space character), but not the colon character (":"), which is reserved for separating reference IDs from sequence ranges (see below). The newline, tab and carriage return characters are also reserved for future use.
+
The ID used by a client or server to refer to a reference object can contain any set of printable characters (including the space character), but not the colon character (":"), which is reserved for separating reference IDs from sequence ranges (see below). The newline, tab and carriage return characters are also reserved for future use.
  
A data source that uses the colon character for its internal IDs must map this character to another one on the way out and on the way in. For example:
+
A data source that uses the colon character for its internal IDs must map this character to another one on the way in and on the way out. For example:
  
 
   
 
   
Line 279: Line 249:
 
   
 
   
 
     gi-123456:1,1000 --> gi:123456 start=1 stop=1000  --->  gi-123456:1,1000
 
     gi-123456:1,1000 --> gi:123456 start=1 stop=1000  --->  gi-123456:1,1000
 +
 +
 +
<font color="blue">In general, DAS mandates that a server must respond in the same coordinate system by which it is queried. This is relevant where annotations can potentially exist in several coordinate systems (such as clones and contigs).</font>
 
   
 
   
  
Line 285: Line 258:
 
==The Queries==
 
==The Queries==
  
This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as ''PREFIX''. The other meta-variable used in these examples is ''DSN'', which is a symbolic data source. (As seen the the [#request  above example.]) Data sources are standardized across DAS servers in such a way that a data source name has a one-to-one correspondence with a reference sequence.
+
This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as ''PREFIX''. The other meta-variable used in these examples is ''DSN'', which is a symbolic data source (as seen in the [#request  above example.])
 +
 
 +
<font color="blue">At present, there is no implementation of the "assembly traversal' features of DAS. In the interests of simplicity, we could opt for removing this capacity. This would involve removing:
 +
 
 +
* entry_points: subparts and orientation attributes (orientation only makes sense if you have other information about how entry points relate to each other)
 +
* features: reference, superparts and subparts attributes
 +
</font>
 +
 
 +
===Sources Command===
  
===Retrieve the List of Data Sources===
+
''Retrieve the list of data sources for a server.''
<font color="red">DSN command has been deprecated in favour of the sources cmd</font>
+
 
 +
<font color="red">DSN command has been deprecated in favour of this sources cmd</font>
  
 
'''Scope:''' Reference and annotation servers.
 
'''Scope:''' Reference and annotation servers.
  
'''Command:''' ''Sources''
+
'''Command:''' ''sources''
  
 
'''Format:'''
 
'''Format:'''
  
 
<code>
 
<code>
 
 
 
  ''PREFIX''/das/sources
 
  ''PREFIX''/das/sources
 
 
</code>
 
</code>
  
Line 308: Line 287:
 
<ul>
 
<ul>
 
<li>The email address of the maintainer of a DAS source</li>
 
<li>The email address of the maintainer of a DAS source</li>
<li>The <a href="help_coordsys.jsp">coordinate system</a>(namespace) of the provided data</li>
+
<li>The coordinate system of the provided data</li>
<li>different properties that allow to describe a server closer</li>
+
<li>Different properties that allow further description of a source</li>
 
</ul>
 
</ul>
</p>
 
<br/>
 
  
<b>Scope:</b> all DAS servers
+
'''Arguments:''' none
  
<br/>
+
====Response:====
 
 
<b>Command:</b> <i>sources</i>
 
 
 
<br/>
 
 
 
<b>Format:</b>
 
<pre>
 
 
 
<i>PREFIX</i>/das[1]/sources
 
 
 
</pre>
 
 
 
The PREFIX can be either <b>das</b> or <b>das1</b> in order to refer to the major version 1 of the DAS protocol
 
and in order to provide support for the future das2 protocol.
 
<br/>
 
 
 
<br/>
 
<b>Description:</b> This query returns the meta information for a DAS server
 
<br/>
 
<b>Arguments:</b>
 
none
 
<br/>
 
  
<h4>Response:</h4>
+
The response to the ''sources'' command is the "DASSSOURCE" XML-formatted document:
 
 
 
 
<br/>
 
 
 
The response to the <i>sources</i> command is the "DASSSOURCE" XML-formatted document:
 
  
 
<blockquote>
 
<blockquote>
Line 355: Line 305:
 
     &lt;MAINTAINER email="email address" /&gt;
 
     &lt;MAINTAINER email="email address" /&gt;
 
     &lt;VERSION uri="URI" created="date"&gt;
 
     &lt;VERSION uri="URI" created="date"&gt;
 
 
       &lt;COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string&lt;/COORDINATES&gt;       
 
       &lt;COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string&lt;/COORDINATES&gt;       
 
       &lt;CAPABILITY type="das1:command" query_uri="URL" /&gt;
 
       &lt;CAPABILITY type="das1:command" query_uri="URL" /&gt;
Line 365: Line 314:
 
</blockquote>
 
</blockquote>
  
 
 
<br/>
 
 
<b>Format:</b>
 
<b>Format:</b>
 
<div id="table">
 
<div id="table">
Line 375: Line 321:
 
<td>xml-stylesheet</td>
 
<td>xml-stylesheet</td>
 
<td>optional</td>
 
<td>optional</td>
<td>an XSL stylesheet that e.g. allows a browser to nicely display the XML response </td>
+
<td>an XSL stylesheet that e.g. allows a browser to nicely display the XML response <font color="blue">I'm not sure whether this should actually be part of the spec - could be confused with stylesheet command?</font><font color="red"> We should probably highlight the fact that there is a difference and that this is for display in a web browser not how to display in a client.</font> </td>
 
</tr>
 
</tr>
  
Line 421: Line 367:
 
<td>VERSION</td>
 
<td>VERSION</td>
 
<td>mandatory</td>
 
<td>mandatory</td>
<td>in principle this would allow hosting several versions of a DAS sources (with unque uris)  
+
<td>in principle this would allow hosting several versions of a DAS sources (with unique URIs)  
 
on a server, but in practise most people
 
on a server, but in practise most people
provide only the server with the latest data. the created attribute provides the date on which a DAS server has been set up initially.
+
provide only the server with the latest data. <font color="blue">Different versions of the same source should be considered to be''equivalent'', that is the latest version is definitive.</font> The created attribute provides the date on which a DAS server has been set up initially.
 
For a DAS registation server this is the date at which a DAS server has been pulished.
 
For a DAS registation server this is the date at which a DAS server has been pulished.
 
  </td>
 
  </td>
Line 434: Line 380:
 
<td>mandatory, one or many</td>
 
<td>mandatory, one or many</td>
  
<td>The description of the namespace of a DAS source. <br/>
+
<td>The description of the coordinate system(s) a DAS source operates on. <br/>
<b>uri</b> - the unique URI for a DAS source. For a DAS registration server these
+
<b>uri</b> - the unique URI for a DAS coordinate system. For a DAS registration server these
should be resolvable and allow to access more information about this.  
+
should be resolvable and allow to access more information.  
e.g. <a href="http://www.dasregistry.org/dasregistry/coordsys/CS_DS6">http://www.dasregistry.org/dasregistry/coordsys/CS_DS6</a>
+
e.g. [http://www.dasregistry.org/dasregistry/coordsys/CS_DS6] for the UniProt,Protein Sequence coordinate system. <br/>
for the UniProt,Protein Sequence coordinate system. <br/>
 
  
 
<b>source</b> - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available:
 
<b>source</b> - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available:
Line 478: Line 423:
  
 
<ul>
 
<ul>
<li> <a href="http://www.dasregistry.org/das1/sources">http://www.dasregistry.org/das1/sources</a>
+
<li> [http://www.dasregistry.org/das/sources http://www.dasregistry.org/das/sources]
- the listing of DAS/1 sources at the DAS registration server</li>
+
- the listing of sources at the DAS registration server</li>
  
<li> <a href="http://www.ensembl.org/das/sources">http://www.ensembl.org/das/sources</a>
+
<li> [http://www.ensembl.org/das/sources http://www.ensembl.org/das/sources]
 
- the DAS sources provided by Ensembl. The DAS registration server uses this listing
 
- the DAS sources provided by Ensembl. The DAS registration server uses this listing
 
to automatically update the registration for these DAS servers.</li>
 
to automatically update the registration for these DAS servers.</li>
<li> <a href="http://vega.sanger.ac.uk/das/sources">http://vega.sanger.ac.uk/das/sources</a>
+
<li> [http://vega.sanger.ac.uk/das/sources http://vega.sanger.ac.uk/das/sources]
 
- the VEGA DAS sources</li>
 
- the VEGA DAS sources</li>
 
</ul>
 
</ul>
Line 493: Line 438:
 
----
 
----
  
===Retrieve the List of Entry Points for a Data Source===
+
===Entry Points Command===
 +
 
 +
''Retrieve the list of reference objects for a data source''
 +
 
 
<font color="red">This Entry_Points cmd is now mandatory for reference servers.</font>
 
<font color="red">This Entry_Points cmd is now mandatory for reference servers.</font>
 +
 
'''Scope:''' Reference servers.
 
'''Scope:''' Reference servers.
  
Line 502: Line 451:
  
 
<code>
 
<code>
 
 
 
  ''PREFIX''/das/''DSN''/entry_points
 
  ''PREFIX''/das/''DSN''/entry_points
 
 
 
</code>
 
</code>
  
Line 525: Line 470:
  
 
<code>
 
<code>
 
 
 
  <?xml version="1.0" standalone="no"?>
 
  <?xml version="1.0" standalone="no"?>
 
  <!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
 
  <!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
Line 539: Line 482:
 
   </ENTRY_POINTS>
 
   </ENTRY_POINTS>
 
  </DASEP>
 
  </DASEP>
 
 
</code>
 
</code>
  
Line 547: Line 489:
 
: The appropriate doctype and root tag is DASEP.
 
: The appropriate doctype and root tag is DASEP.
 
; <ENTRY_POINTS> (<font color="red">The start and stop are now optional</font>, only one)
 
; <ENTRY_POINTS> (<font color="red">The start and stop are now optional</font>, only one)
: There is a single <ENTRY_POINTS> tag. It has a version number (required) in the form "N.NN". Whenever the DNA of the entry point changes, the version number should change as well. The '''href''' (required) attribute echoes the URL query that was used to fetch the current document.
+
: There is a single <ENTRY_POINTS> tag. It has a version number (required) in the form "N.NN". Whenever the DNA of the entry point changes, the version number should change as well. <font color="blue">This is not implemented to my knowledge. Versioning is handled by coordinate systems, or explicitly for each segment. I suggest this be DEPRECATED.</font> The '''href''' (required) attribute echoes the URL query that was used to fetch the current document.
 
; <SEGMENT> (optional; zero or more)
 
; <SEGMENT> (optional; zero or more)
 
: Each segment contains the attributes '''id''', '''start''', '''stop''' and '''orientation'''. The id is a unique identifier, which can be used as the reference ID in further requests to DAS. The start and stop indicate the start and stop positions of the segment. Orientation is one of "+" or "-" and indicates the strandedness of the segment (use "+" if the segment is not intrinsically ordered)<font color="red">The orientation is now optional.</font>. If the optional '''subparts''' attribute is present and has the value "yes", it indicates that the segment has subparts.<font color="red">The subparts section is now deprecated?</font><font color="red"> The type section is now deprecated as this should be specified by the registry</font>.For compatibility with older versions of the specification, the <SEGMENT> tag can use a '''size''' attribute rather than '''start''' and '''stop''', and can omit the '''orientation''' attribute:  
 
: Each segment contains the attributes '''id''', '''start''', '''stop''' and '''orientation'''. The id is a unique identifier, which can be used as the reference ID in further requests to DAS. The start and stop indicate the start and stop positions of the segment. Orientation is one of "+" or "-" and indicates the strandedness of the segment (use "+" if the segment is not intrinsically ordered)<font color="red">The orientation is now optional.</font>. If the optional '''subparts''' attribute is present and has the value "yes", it indicates that the segment has subparts.<font color="red">The subparts section is now deprecated?</font><font color="red"> The type section is now deprecated as this should be specified by the registry</font>.For compatibility with older versions of the specification, the <SEGMENT> tag can use a '''size''' attribute rather than '''start''' and '''stop''', and can omit the '''orientation''' attribute:  
Line 558: Line 500:
 
----
 
----
  
===<font color="red">Retrieve the DNA Associated with a Subsequence has been deprecated as the sequence cmd below is more commonly used.</font>===
+
===DNA Command===
  
 +
<font color="red">Deprecated as the sequence cmd below is more commonly used.</font>
  
 
----
 
----
===Retrieve the Sequence Associated with a Subsequence===
+
 
 +
===Sequence Command===
 +
 
 +
''Retrieve all or part of the sequence for a reference object.''
 +
 
 
<b>Scope:</b> Reference servers.
 
<b>Scope:</b> Reference servers.
  
 
<b>Command:</b> <i>sequence</i>
 
<b>Command:</b> <i>sequence</i>
 
  
 
<b>Format:</b>
 
<b>Format:</b>
  
<blockquote><pre>
+
<code>
<i>PREFIX</i>/das/<i>DSN</i>/sequence?segment=<i>RANGE</i>[;segment=<i>RANGE</i>...]
+
</pre></blockquote>
+
''PREFIX''/das/''DSN''/sequence?segment=''RANGE''[;segment=''RANGE''...]
 
+
 +
</code>
  
 
<b>Description:</b> This query returns the sequence (nucleotide or
 
<b>Description:</b> This query returns the sequence (nucleotide or
 
protein) corresponding to the indicated segment.
 
protein) corresponding to the indicated segment.
 
 
  
 
<b>Arguments:</b>
 
<b>Arguments:</b>
Line 596: Line 541:
  
 
<pre>
 
<pre>
     http://www.wormbase.org/db/das/elegans/sequence?
+
     http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/sequence?
         segment=BUM;segment=HUM_HGA;segment=CE_HOC2:1,200
+
         segment=P00280;segment=P15056;segment=P51587:200,300
 
</pre>
 
</pre>
  
====The Sequence Response====
+
====Response:====
 
 
 
 
The response to <i>dna</i> is the "DASSEQUENCE" XML-formatted document.
 
  
 +
The response to <font color="blue"><i>sequence</i></font> is the "DASSEQUENCE" XML-formatted document.
  
 
<b>Format:</b>
 
<b>Format:</b>
Line 613: Line 556:
 
&lt;DASSEQUENCE&gt;
 
&lt;DASSEQUENCE&gt;
  
   &lt;SEQUENCE id="<i>id</i>" start="<i>start</i>" stop="<i>stop</i>"
+
   &lt;SEQUENCE id="id" start="start" stop="stop">
               moltype="<i>moltype</i>" version="X.XX"&gt;
+
                
 
       atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
 
       atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
 
       taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
 
       taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
Line 639: Line 582:
 
<dl>
 
<dl>
 
   <dt>&lt;!DOCTYPE&gt; (required; one only)
 
   <dt>&lt;!DOCTYPE&gt; (required; one only)
   <dd>The doctype indicates which formal DTD specification to use.
+
   <dd><font color="red">xsd instead of dtd</font>.
      For the sequence query, the doctype DTD is "http://www.biodas.org/dtd/dassequence.dtd".
 
      <p>
 
 
   <dt>&lt;DASSEQUENCE&gt; (required; one only)  
 
   <dt>&lt;DASSEQUENCE&gt; (required; one only)  
 
   <dd>The appropriate doctype and root tag is DASSEQUENCE.
 
   <dd>The appropriate doctype and root tag is DASSEQUENCE.
      <p>
 
 
   <dt>&lt;SEQUENCE&gt; (required; one or more)  
 
   <dt>&lt;SEQUENCE&gt; (required; one or more)  
   <dd>There is a single &lt;SEQUENCES&gt; tag per requested segment. It has the  
+
   <dd>There is a single &lt;SEQUENCES&gt; tag per requested segment.
attributes <b>id</b>, which indicates the reference ID for this sequence,
+
      It has the attributes <b>id</b>, which indicates the reference ID for this sequence, <b>start</b> and <b>stop</b>, which indicate the position of this segment within the reference sequence, <font color="red">Deprecate this as not consistent with registry and coordinate system?</font> <font color="blue">Yep</font> <b>moltype</b>, which indicates the molecular type of the sequence, and <b>version</b>, which provides the version of the reference sequence.
      <b>start</b> and <b>stop</b>, which indicate the position of
 
      this segment within the reference sequence, <b>moltype</b>,
 
      which indicates the molecular type of the sequence, and <b>version</b>,
 
      which provides the sequence map version number. All five
 
      attributes are required.
 
      <p>
 
 
 
 
       The molecule type is one of <i>DNA</i>, <i>ssRNA</i>,
 
       The molecule type is one of <i>DNA</i>, <i>ssRNA</i>,
 
       <i>dsRNA</i>, or <i>Protein</i>.  No provision is made for
 
       <i>dsRNA</i>, or <i>Protein</i>.  No provision is made for
 
       circular molecules.
 
       circular molecules.
       <p>
+
       The version may be either a numerical value or a digest such as MD5 checksum.  All five attributes are required.
 
       The content of this tag is the sequence itself, using standard
 
       The content of this tag is the sequence itself, using standard
 
       IUPAC codes for DNA, RNA and protein.
 
       IUPAC codes for DNA, RNA and protein.
 
</dl>
 
</dl>
  
 +
===Types Command===
  
</td>
+
''Retrieve the types of features offered by a data source''
  
</tr>
+
<font color="red"> how do we reconcile the way UCSC and ensembl uses the type command i.e. UCSC use it as a filter for tracks from one source, whereas ensembl only has one track per source!!! Can't deprecate this command as is used by UCSC???</font> <font color="blue">Make the unit of registration in the registry the combination of the source and type(s), and we will make Ensembl will honour it and apply the filter.</font>
</table>
 
 
 
===Retrieve the Types Available for a Segment===
 
  
 
'''Scope:''' Annotation and reference servers.
 
'''Scope:''' Annotation and reference servers.
Line 695: Line 626:
 
: This is the sequence range. It uses the format format ''reference:start,stop'', where ''reference'' is the ID of the reference sequence used to establish the coordinate system, and ''start'' and ''stop'' are the endpoints of the region to query, inclusive.
 
: This is the sequence range. It uses the format format ''reference:start,stop'', where ''reference'' is the ID of the reference sequence used to establish the coordinate system, and ''start'' and ''stop'' are the endpoints of the region to query, inclusive.
 
; '''type''' (optional)
 
; '''type''' (optional)
: One or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be used.
+
: <font color="blue">I can't see that this is really needed. Deprecate?</font> One or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be used.
  
 
If one or more segment arguments are provided, the list of types returned is restricted to the indicated segments. If no segment argument is provided, then '''all''' feature types known to the source are returned.
 
If one or more segment arguments are provided, the list of types returned is restricted to the indicated segments. If no segment argument is provided, then '''all''' feature types known to the source are returned.
Line 713: Line 644:
 
   <SEGMENT id="''id''" start="''start''" stop="''stop''" type="''type''" version="X.XX" label="''label''">
 
   <SEGMENT id="''id''" start="''start''" stop="''stop''" type="''type''" version="X.XX" label="''label''">
 
   
 
   
       <TYPE id="''id1''" method="''method''" category="''category''">''Type Count 1''</TYPE>
+
       <TYPE id="''id1''" <font color="blue">DEPRECATED method="''method''"</font> category="''category''">''Type Count 1''</TYPE>
       <TYPE id="''id2''" method="''method''" category="''category''">''Type Count 2''</TYPE>
+
       <TYPE id="''id2''" <font color="blue">DEPRECATED method="''method''"</font> category="''category''">''Type Count 2''</TYPE>
 
   
 
   
 
       ...
 
       ...
Line 730: Line 661:
 
: There is a single <GFF> tag. Its '''version''' (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0. The '''href''' (required) attribute echoes the URL query that was used to fetch the current document.
 
: There is a single <GFF> tag. Its '''version''' (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0. The '''href''' (required) attribute echoes the URL query that was used to fetch the current document.
 
; <SEGMENT> (required; one or more)
 
; <SEGMENT> (required; one or more)
: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
+
: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. <font color="blue">DEPRECATE: </font>The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
 
; <TYPE> (optional; zero or more per SEGMENT)
 
; <TYPE> (optional; zero or more per SEGMENT)
: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), '''method''' (optional), which indicates the method (subtype) for the feature type and the '''category''' (optional) attribute, which provides functional grouping to related types. The tag contents (optional) is a count of the number of features of this type across the segment.
+
: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), category (<font color="blue">required</font>) and <font color="blue">method (DEPRECATED - a method relates to a feature, not a type!)</font>. <font color="blue">The content of these correspond to the equivalent values in the '''Features Command'''.</font> The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. <font color="blue">Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.</font>
  
 
----
 
----
  
===Retrieve the Annotations Across a Segment===
+
===Features Command===
 +
 
 +
''Retrieve the annotations for all or part of a reference object''
  
 
'''Scope:''' Reference and annotation servers.
 
'''Scope:''' Reference and annotation servers.
Line 747: Line 680:
  
 
   
 
   
  ''PREFIX''/das/''DSN''/features?segment=''REF:start,stop''[;segment=''REF:start,stop''...]
+
  ''PREFIX''/das/''DSN''/features?segment=''REF[:start,stop]''[;segment=''REF:start,stop''...]
 
                                       [;type=''TYPE'']
 
                                       [;type=''TYPE'']
 
                                       [;type=''TYPE'']
 
                                       [;type=''TYPE'']
 
                                       [;category=''CATEGORY'']
 
                                       [;category=''CATEGORY'']
 
                                       [;category=''CATEGORY'']
 
                                       [;category=''CATEGORY'']
                                       [;categorize=''yes|no'']
+
                                       [;categorize=''yes|no''] <font color="blue">deprecate...</font>
 
                                       <font style="background-color: #DEB887">[;feature_id=ID]</font>
 
                                       <font style="background-color: #DEB887">[;feature_id=ID]</font>
 
 
                                       <font style="background-color: #DEB887">[;group_id=ID]</font>
 
                                       <font style="background-color: #DEB887">[;group_id=ID]</font>
  
Line 764: Line 696:
  
 
; '''segment''' (<font style="background-color: #DEB887">zero</font> or more)
 
; '''segment''' (<font style="background-color: #DEB887">zero</font> or more)
: If specified, the segment argument restricts the list of annotations to those that overlap the indicated range. Each segment argument uses the format format ''reference:start,stop'', where ''reference'' is the ID of the reference sequence used to establish the coordinate system, and ''start'' and ''stop'' are the endpoints of the region to query, inclusive. Multiple segments may be specified.
+
: If specified, the segment argument restricts the list of annotations to those that overlap the indicated <font color="blue">reference object, or a specific range within the reference object. The argument uses the format segment=''reference'' or segment=''reference:start,stop''. Here,</font> ''reference'' is the ID of the reference object used to establish the coordinate system, and ''start'' and ''stop'' are the endpoints of the region to query, inclusive. Multiple segments may be specified. For example: ''features?segment='''REF1:100,200''';segment='''REF2'''''
 
; '''type''' (zero or more)
 
; '''type''' (zero or more)
: Zero or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be relied on.
+
: Zero or more type IDs to be used for filtering annotations on the type field. If multiple type <font color="blue">IDs</font> are provided, the resulting list of features will be the logical OR of the list. <font color="blue">Remove this bit:</font> For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be relied on.
 
; '''category''' (zero or more)
 
; '''category''' (zero or more)
: Zero or more category IDs to be used for filtering annotations by category. If multiple categories are provided, they are treated as the logical OR. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be relied on.
+
: Zero or more category IDs to be used for filtering annotations by category. If multiple categories are provided, they are treated as the logical OR. <font color="blue">Remove this bit:</font> For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is '''deprecated''' and should not be relied on.
 
; '''categorize''' (optional)
 
; '''categorize''' (optional)
: Either "yes" or "no" (default). If "yes", then each annotation must include its functional category.
+
: Either "yes" or "no" (default). If "yes", then each annotation must include its functional category. <font color="blue">This parameter is DEPRECATED. The category is now mandatory in the response.</font>
 
; '''feature_id'''<font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
 
; '''feature_id'''<font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
: Instead of, or in addition to, '''segment''' arguments, you may provide one or more '''feature_id''' arguments, whose values are the identifiers of particular features. If the server supports this operation, it will translate the feature ID into the segment(s) that strictly enclose them and return the result in the ''features'' response. It is possible for the server to return multiple segments if the requested feature is present in multiple locations.
+
: Instead of, or in addition to, '''segment''' arguments, you may provide one or more '''feature_id''' arguments, whose values are the identifiers of particular features. If the server supports this operation, it will translate the feature ID into the segment(s) that strictly enclose them and return the result in the ''features'' response. It is possible for the server to return multiple segments if the requested feature is present in multiple locations. <font color="blue">At the moment the few servers that implement this don't just use feature_id to identify the segment(s), they actually restrict on the feature ID... I'd say this behaviour is more valuable so perhaps we should specify it here. Likewise group_id below:</font>
 
; '''group_id'''<font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
 
; '''group_id'''<font style="background-color: #DEB887"> (zero or more; new in 1.5)</font>
 
: The '''group_id''' argument, is similar to '''feature_id''', but retrieves segments that contain the indicated feature group.
 
: The '''group_id''' argument, is similar to '''feature_id''', but retrieves segments that contain the indicated feature group.
  
Annotation servers are only required to return annotations which are completely contained within the indicated segment. Servers '''may''' also return annotations which overlap the segment, but are not completely contained within them. Annotations '''must''' be returned using the coordinate system in which they were requested. For example, if a contig ID was used to specify the segment, then the annotation endpoints must use contig coordinates.
+
<font color="blue">Servers may offer the same feature on several coordinate systems. In such a case, they will share a common feature ID and thus can be filtered by the client.</font> <font color="red">Annotations '''must''' be returned using the coordinate system in which they were requested. For example, if a contig ID was used to specify the segment, then the annotation endpoints must use contig coordinates.</font>
 +
 
 +
<font color="red">Servers should return annotations which overlap the segment, but are not completely contained within them. Annotation servers are no longer allowed to only return annotations which are completely contained within the indicated segment.</font> <font color="blue">This is confusing. Better as: Servers should return annotations which lie wholly or partially within the query segment. For example:</font>
 +
 
 +
<code>
 +
 +
        -------------------
 +
              Query     
 +
 +
-----  ---  -------    -----------  -----
 +
  A      B      C            D          E 
 +
 +
</code>
 +
 
 +
<font color="blue">In the above example, the server should return annotations B and C because they lie wholly within the query segment, and annotation D because it lies partially within the query segment.</font>
  
 
If multiple segment arguments are provided and they happen to overlap, then the annotation server may return the same annotation multiple times, possibly using different coordinate systems. It is the responsibility of the client to merge annotations based on the assembly.
 
If multiple segment arguments are provided and they happen to overlap, then the annotation server may return the same annotation multiple times, possibly using different coordinate systems. It is the responsibility of the client to merge annotations based on the assembly.
Line 815: Line 761:
 
        <LINK href="''url''"> ''link text'' </LINK>
 
        <LINK href="''url''"> ''link text'' </LINK>
 
   
 
   
        <TARGET id="id" start="x" stop="y">''target name''</TARGET>
+
        <TARGET id="id" start="x" stop="y">''target name''</TARGET> <font color="blue">DEPRECATED</font>
 
           </GROUP>
 
           </GROUP>
 
       </FEATURE>
 
       </FEATURE>
Line 831: Line 777:
 
: The appropriate doctype and root tag is DASGFF.
 
: The appropriate doctype and root tag is DASGFF.
 
; <GFF> (required; one only)
 
; <GFF> (required; one only)
: There is a single <GFF> tag. Its '''version''' (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0 The '''href''' (required) attribute echoes the URL query that was used to fetch the current document.
+
: There is a single <GFF> tag. Its '''version''' (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0 The '''href''' (required) attribute echoes the URL query that was used to fetch the current document. <font color="blue">Not used - deprecate in favour of the capabilities headers and registry?</font>
 
; <SEGMENT> (required; one or more)
 
; <SEGMENT> (required; one or more)
: The <SEGMENT> tag provides information on the reference segment coordinate system. The '''id''', '''start''' and '''stop''' attributes indicate the position of the segment. The '''version''' attribute indicates the current version of the sequence map. The id, start, stop, and version attributes are required. The optional '''label''' attribute provides a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
+
: The <SEGMENT> tag provides information on the reference segment coordinate system. The '''id''', '''start''' and '''stop''' attributes indicate the position of the segment. <font color="blue">Since start and stop are no longer required query parameters, should they be optional in the response?</font> The '''version''' attribute indicates the current version of the sequence map. The id, start, stop, and version attributes are required. The optional '''label''' attribute provides a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing. <font color="blue">If anything the type should refer to the coordinate system IMO - deprecate or change?</font>
 
; <FEATURE> (optional; zero or more per SEGMENT)
 
; <FEATURE> (optional; zero or more per SEGMENT)
 
: There are zero or more <FEATURE> tags per <SEGMENT>, each providing information on one annotation. The '''id''' attribute (required) is a unique identifier for the feature. It can be used as a reference point for further navigation. The '''label''' attribute (optional) is a suggested label to display for the feature. If not present, the '''id''' attribute can be used instead.
 
: There are zero or more <FEATURE> tags per <SEGMENT>, each providing information on one annotation. The '''id''' attribute (required) is a unique identifier for the feature. It can be used as a reference point for further navigation. The '''label''' attribute (optional) is a suggested label to display for the feature. If not present, the '''id''' attribute can be used instead.
 
; <TYPE> (required; one per FEATURE)
 
; <TYPE> (required; one per FEATURE)
: Each feature has just one <TYPE> field, which indicates the type of the annotation. The attributes are '''id''' (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), and the '''category''' (optional, recommended) attribute, which provides functional grouping to related types. The reference server's annotations can consist of additional overlapping landmarks (parents, children, and neighbors), which should be marked "yes" in the third attribute '''reference''' (optional, defaults to "no") to indicate that the feature is a structural landmark within the map (this feature can be annotated). The tag contents (optional) is a human readable label for display purposes.If a '''reference''' annotation has either or both of the optional attributes, '''subparts="yes"''' and '''superparts="yes"''', then in addition to being useable as a reference sequence, the feature contains subparts and/or superparts that themselves can act as reference features. This can be used to reconstruct reference server's assembly. See also [#fetching_assembly Fetching Assembly Information].
+
: Each feature has just one <TYPE> field, which indicates the type of the annotation. <font color="blue">See the '''Feature Types and Categories''' section for details of what this tag should contain. HAVE REMOVED REFERENCE/SUBPARTS/SUPERPARTS ATTRIBUTES.</font>
 
; <METHOD> (required; one per FEATURE)
 
; <METHOD> (required; one per FEATURE)
: Each feature has one <METHOD> field, which identifies the method used to identify the feature. The '''id''' (optional) tag can be used to retrieve further information from the annotation server. The tag contents (optional) is a human readable label.
+
: Each feature has one <METHOD> field, which identifies the method used to identify the feature<font color="blue">, such as an experiment or algorithm. DELETE: The '''id''' (optional) tag can be used to retrieve further information from the annotation server. </font>The tag contents (optional) is a human readable label.
; <START>, <END> (required; one apiece per FEATURE)
+
; <START>, <END> (<font color="red"> optional</font>; one apiece per FEATURE)
: These tags indicate the start and end of the feature in the coordinate system of the reference sequence given in the <SEGMENT> tag. The relationship between the feature start and stop positions and the segment start and stop is that the two spans are guaranteed to overlap.
+
: These tags indicate the start and end of the feature in the coordinate system of the reference sequence given in the <SEGMENT> tag. The relationship between the feature start and stop positions and the segment start and stop is that the two spans are guaranteed to overlap <font color="blue">wholly or partially. Non-positional features do not have a start or end.</font>
; <SCORE> (required; one per FEATURE)
+
; <SCORE> (<font color="red"> optional</font>; one per FEATURE)
: This is a floating point number indicating the "score" of the method used to find the current feature. The number can only be understood in the context of information retrieved from the server by linking to the method. If this field is inapplicable, the contents of the tag can be replaced with a '''-''' symbol.
+
: This is a floating point number indicating the "score" of the method used to find the current feature. The number can only be understood in the context of information retrieved <font color="blue">Replace with: "via the <LINK> element." from the server by linking to the method.</font> If this field is inapplicable, the contents of the tag can be replaced with a '''-''' symbol. <font color="blue">Omitting this element is equivalent to a value of '''-'''</font>
; <ORIENTATION> (required; one per FEATURE)
+
; <ORIENTATION> (<font color="red"> optional</font>; one per FEATURE)
: This tag indicates the orientation of the feature relative to the direction of transcription. It may be for features that are unrelated to transcription, '''+''', for features that are on the sense strand, and '''-''', for features on the antisense strand.
+
: This tag indicates the orientation of the feature relative to the direction of transcription. It may be '''0''' for features that are unrelated to transcription, '''+''', for features that are on the sense strand, and '''-''', for features on the antisense strand. <font color="blue">Omitting this element is equivalent to a value of '''0'''.</font>
; <PHASE> (required; one per FEATURE)
+
; <PHASE> (<font color="red"> optional</font>; one per FEATURE)
: This tag indicates the position of the feature relative to open reading frame, if any. It may be one of the integers , '''1''' or '''2''', corresponding to each of the three reading frames, or '''-''' if the feature is unrelated to a reading frame.
+
: This tag indicates the position of the feature relative to open reading frame, if any. It may be one of the integers '''0''', '''1''' or '''2''', corresponding to each of the three reading frames, or '''-''' if the feature is unrelated to a reading frame. <font color="blue">Omitting this element is equivalent to a value of '''-'''.</font>
 
; <NOTE> (optional; zero or more per FEATURE)
 
; <NOTE> (optional; zero or more per FEATURE)
 
: A human-readable note in plain text format.
 
: A human-readable note in plain text format.
Line 853: Line 799:
 
: A link to a web page somewhere that provides more information about this feature. The '''href''' (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
 
: A link to a web page somewhere that provides more information about this feature. The '''href''' (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
 
; <TARGET> (optional; zero or more per FEATURE)
 
; <TARGET> (optional; zero or more per FEATURE)
: The target sequence in a sequence similarity match. The '''id''' attribute provides the reference ID for the target sequence, and the '''start''' and '''stop''' attributes indicate the segment that matched across the target sequence. All three attributes are required. More information on the target can be retrieved by linking back to the annotation server. See [#feature_linking Linking to a Feature].
+
: <font color="blue">DEPRECATED</font> The target sequence in a sequence similarity match. The '''id''' attribute provides the reference ID for the target sequence, and the '''start''' and '''stop''' attributes indicate the segment that matched across the target sequence. All three attributes are required. More information on the target can be retrieved by linking back to the annotation server. See [#feature_linking Linking to a Feature].
 
; <GROUP> (optional; zero or more per FEATURE)
 
; <GROUP> (optional; zero or more per FEATURE)
: The <GROUP> section is slightly odd, as it is derived from an overloaded field in the GFF flat file format. It provides a unique "group" ID that indicates when certain features are related to each other. The canonical example is the CDS, exons and introns of a transcribed gene, which logically belong together. The group '''id''' attribute (required) provides an identifier that should be used by the client to group features together visually. Unlike other IDs in this protocol, the group ID cannot be used as a database handle to retrieve further information about the group. Such information can, however, be provided within <GROUP> section, which may contain up to three optional tags.The '''label''' attribute (optional) provides a human-readable string that can be used in graphical representations to label the glyph.The '''type''' attribute (optional) provides a type ID for the group as a whole, for example "transcript". This ID can be used as a key into the [#stylesheet stylesheet] to select the glyph and graphical characteristics for the group as a whole.
+
: The <GROUP> section is slightly odd, as it is derived from an overloaded field in the GFF flat file format. It provides a unique "group" ID that indicates when certain features are related to each other. The canonical example is the CDS, exons and introns of a transcribed gene, which logically belong together. The group '''id''' attribute (required) provides an identifier that should be used by the client to group features together visually. <font color="blue">Removing linking to features anyway... remove next sentence:</font> Unlike other IDs in this protocol, the group ID cannot be used as a database handle to retrieve further information about the group. Such information can, however, be provided within <GROUP> section, which may contain up to three optional tags.The '''label''' attribute (optional) provides a human-readable string that can be used in graphical representations to label the glyph.The '''type''' attribute (optional) provides a type ID for the group as a whole, for example "transcript". This ID can be used as a key into the [#stylesheet stylesheet] to select the glyph and graphical characteristics for the group as a whole.
 
;; <NOTE> (optional; zero or more per GROUP)
 
;; <NOTE> (optional; zero or more per GROUP)
:: A human-readable note in plain text format.
+
:: A human-readable note in plain text format. <font color="blue">Some sources embed HTML here e.g. arrayexpress... what do we do about these?</font>
 
;; <LINK> (optional; zero or more per GROUP)
 
;; <LINK> (optional; zero or more per GROUP)
 
:: A link to a web page somewhere that provides more information about this group. The '''href''' (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
 
:: A link to a web page somewhere that provides more information about this group. The '''href''' (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
 
;; <TARGET> (optional; zero or more per GROUP)
 
;; <TARGET> (optional; zero or more per GROUP)
:: The target sequence in a sequence similarity match. The '''id''' attribute provides the reference ID for the target sequence, and the '''start''' and '''stop''' attributes indicate the segment that matched across the target sequence. All three attributes are required. NOTE: although this tag is present in the GROUP section, it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE> section. Earlier versions of this specification placed the TARGET tag in the GROUP section, and clients must recognize and accomodate this.
+
:: <font color="blue">DEPRECATED</font> The target sequence in a sequence similarity match. The '''id''' attribute provides the reference ID for the target sequence, and the '''start''' and '''stop''' attributes indicate the segment that matched across the target sequence. All three attributes are required. NOTE: although this tag is present in the GROUP section, it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE> section. Earlier versions of this specification placed the TARGET tag in the GROUP section, and clients must recognize and accomodate this.
 +
 
 +
It is intended that annotation servers provide pointers to human-readable data that describes its features and methods in more detail.
 +
 
 +
====Examples====
 +
<code>
 +
<DASGFF>
 +
    <GFF href="http://das.sanger.ac.uk/das/pfam/features">
 +
      <SEGMENT id="P08487" version="d1dfb367c112d4820eeffe4eab1d6487" start="1" stop="1291">
 +
          <FEATURE id="C2" label="C2:1090-1177">
 +
            <TYPE id="SO:0000417" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_domain</TYPE>
 +
            <START>1090</START>
 +
            <END>1177</END>
 +
            <METHOD id="Pfam">Pfam-A</METHOD>
 +
            <SCORE>1.7e-18</SCORE>
 +
            <NOTE>HMMER Version: 2.3.2</NOTE>
 +
            <LINK href="http://pfam.sanger.ac.uk/family?entry=PF00168">C2</LINK>
 +
          </FEATURE>
 +
      </SEGMENT>
 +
    </GFF>
 +
</DASGFF>
 +
</code>
 +
 
 +
===Exception Handling for Invalid Segments===
 +
 
 +
<font color="blue">Rewritten this section, no longer "new"</font>
 +
 
 +
A request for the sequence or annotations of a named segment may fail because either:
 +
# the requested segment is outside the bounds of the reference object.
 +
# the reference object is not known to the server
 +
 
 +
In both cases, an exception is indicated by issuing an <ERRORSEGMENT> or <UNKOWNSEGMENT> tag instead of the usual <SEGMENT> tag. In the case of a request for multiple segments, the server will return a mixture of <SEGMENT> sections for valid segments, and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for invalid ones:
 +
 
 +
<code>
 +
<ERRORSEGMENT id="id" start="start" stop="stop">
 +
<UNKNOWNSEGMENT id="id" start="start" stop="stop">
 +
<SEGMENT id="id" start="start" stop="stop" version="version">
 +
    ...
 +
</SEGMENT>
 +
</code>
 +
 
 +
The '''id''' attribute (required) corresponds to the ID of the requested segment, and '''start''' and '''stop''' (optional) correspond to the ''requested'' bounds of the segment (if this was specified).
 +
 
 +
An <UNKNOWNSEGMENT> exception will only be raised if:
 +
# the reference object is not known to the server '''AND'''
 +
# the server can not authoritatively identify that the requested segment is erroneous
 +
Otherwise an <ERRORSEGMENT> exception is raised.
  
{| border="1" bgcolor="#DEB887"
+
For example a reference server, which is authoritative for the coordinate system, knows that any reference object it cannot identify must be erroroneous. It will therefore raise an <ERRORSEGMENT>. By contrast an annotation server, which is not required to know the identities of all the reference objects in the coordinate system, should respond by issuing an <UNKNOWNSEGMENT> tag - it does not know whether the request is erroneous or not. All servers should issue <ERRORSEGMENT> exceptions when they detect a query segment that is beyond the range of a reference object.
! New in version 1.5: Exception Handling for Invalid Segments
 
|-
 
|
 
The request for a named segment may fail because: (1) the reference sequence is not known to the server or (2) the requested region is outside the bounds of the segment. In both cases, an exception is indicated. In the case of a reference server, which is expected to be authoritative for the map, the <GFF> section will flag the problem by issuing an <ERRORSEGMENT> tag instead of the usual <SEGMENT> tag. This tag has the following format:<code> <ERRORSEGMENT id="id" start="start" stop="stop"></code>The '''id''' attribute (required) corresponds to the ID of the requested segment, and '''start''' and '''stop''' (optional) correspond to the requested bounds of the segment if this was specified in the request.Unlike a reference server, an annotation server is not required to know the identities of all the segments. Therefore when presented with a segment ID that it doesn't recognize, it can't know whether this is a true client error or merely an unannotated segment. In this case, an annotation server will issue an <UNKNOWNSEGMENT> tag. This tag has the same syntax as <ERRORSEGMENT> but doesn't necessarily imply an error.If an annotation server detects a request for a region outside the bounds of a segment that it has annotated, it will issue an <ERRORSEGMENT> exception.In the case of a request for multiple segments, the server will return a mixture of <SEGMENT> sections for valid segments, and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for invalid ones.
 
|}
 
  
 
----
 
----
  
===Linking to a Feature===
+
===Link command===
 +
 
 +
''Linking to a feature.''
 +
 
 +
<font color="red">We are proposing to remove this command, as implementations tend to use a separate web server anyway
  
 
'''Scope:''' Annotation servers.
 
'''Scope:''' Annotation servers.
Line 902: Line 893:
  
 
'''Response:''' A web page.
 
'''Response:''' A web page.
 +
</font>
 +
----
  
----
+
===Stylesheet Command===
  
===Retrieving the Stylesheet===
+
''Retrieve guidelines for how to render annotations offered by a server.''
  
 
'''Scope:''' Annotation servers.
 
'''Scope:''' Annotation servers.
Line 914: Line 907:
  
 
<code>
 
<code>
 
 
   
 
   
 
  ''PREFIX''/das/''DSN''/stylesheet
 
  ''PREFIX''/das/''DSN''/stylesheet
Line 926: Line 918:
 
====Response:====
 
====Response:====
  
This document is intended to provide hints to the annotation display client. It maps feature categories and individual types to a series of glyphs known to the display client.
+
This document is intended to provide hints to the annotation display client. It maps feature categories and types to a series of glyphs known to the display client.
  
 
'''Format:'''
 
'''Format:'''
  
 
<code>
 
<code>
 
 
   
 
   
 
  <?xml version="1.0" standalone="no"?>
 
  <?xml version="1.0" standalone="no"?>
Line 1,056: Line 1,047:
 
   
 
   
 
  ...
 
  ...
       <CATEGORY id="Similarity">
+
       <CATEGORY id="inferred from similarity (ECO:0000041)">
 
  <TYPE id="default">
 
  <TYPE id="default">
 
      <GLYPH>
 
      <GLYPH>
 
 
                   <LINE>
 
                   <LINE>
 
        <FGCOLOR>gray</FGCOLOR>
 
        <FGCOLOR>gray</FGCOLOR>
Line 1,065: Line 1,055:
 
      </GLYPH>
 
      </GLYPH>
 
  </TYPE>
 
  </TYPE>
+
  <TYPE id="SO:0001066">
  <TYPE id="NN">
 
 
      <GLYPH >
 
      <GLYPH >
 
                   <BOX>
 
                   <BOX>
Line 1,072: Line 1,061:
 
        <FGCOLOR>black</FGCOLOR>
 
        <FGCOLOR>black</FGCOLOR>
 
        <BGCOLOR>red</BGCOLOR>
 
        <BGCOLOR>red</BGCOLOR>
 
 
                   </BOX>
 
                   </BOX>
 
      </GLYPH>
 
      </GLYPH>
 
  </TYPE>
 
  </TYPE>
  <TYPE id="NP">
+
  <TYPE id="SO:0100013">
 
      <GLYPH>
 
      <GLYPH>
 
                   <TOOMANY>
 
                   <TOOMANY>
 
 
        <HEIGHT>4</HEIGHT>
 
        <HEIGHT>4</HEIGHT>
 
        <FGCOLOR>black</FGCOLOR>
 
        <FGCOLOR>black</FGCOLOR>
 
        <BGCOLOR>blue</BGCOLOR>
 
        <BGCOLOR>blue</BGCOLOR>
 
                   </TOOMANY>
 
                   </TOOMANY>
 
 
      </GLYPH>
 
      </GLYPH>
 
  </TYPE>
 
  </TYPE>
  <TYPE id="PN">
+
  <TYPE id="SO:0001073">
 
      <GLYPH>
 
      <GLYPH>
 
                   <BOX>
 
                   <BOX>
 
        <HEIGHT>3</HEIGHT>
 
        <HEIGHT>3</HEIGHT>
 
 
        <FGCOLOR>blue</FGCOLOR>
 
        <FGCOLOR>blue</FGCOLOR>
 
        <BGCOLOR>green</BGCOLOR>
 
        <BGCOLOR>green</BGCOLOR>
Line 1,097: Line 1,082:
 
      </GLYPH>
 
      </GLYPH>
 
  </TYPE>
 
  </TYPE>
+
  <TYPE id="SO:0001074">
  <TYPE id="PP">
 
 
      <GLYPH>
 
      <GLYPH>
 
                   <SPAN>
 
                   <SPAN>
 
        <HEIGHT>4</HEIGHT>
 
        <HEIGHT>4</HEIGHT>
 
        <FGCOLOR>gray</FGCOLOR>
 
        <FGCOLOR>gray</FGCOLOR>
 
 
                   </SPAN>
 
                   </SPAN>
 
      </GLYPH>
 
      </GLYPH>
Line 1,111: Line 1,094:
 
   
 
   
  
Groups can also have stylesheet entries. If present, they are located in the category named "group". Typically a group will be associated with the "line" glyph, which as described below, draws connections between the members of a group.
+
<font color="blue">Provide an ontology-updated stylesheet: </font>A sample stylesheet used for the WormBase DAS server can be found at [sample_stylesheet.xml http://www.biodas.org/documents/sample_stylesheet.xml].
 +
 
 +
====Glyph Types====
 +
 
 +
This section describes a set of generic "glyphs" that can be used by sequence display programs to display the position of features on a sequence map. The annotation server may use these glyphs to send display suggestions to the viewer via the [#stylesheet stylesheet document].
 +
 
 +
The current set of glyph ID values are:
 +
 
 +
* ARROW
 +
* ANCHORED_ARROW
 +
* BOX
 +
* CROSS
 +
* EX
 +
* HIDDEN
 +
* LINE
 +
* SPAN
 +
* TEXT
 +
* TOOMANY
 +
* TRIANGLE
 +
* PRIMERS
 +
 
 +
Each glyph has a set of attributes associated with it. Attribute values come in the following flavors. <font color="blue">Note that these are ''types''' of element, not element names.</font>
  
A sample stylesheet used for the WormBase DAS server can be found at [sample_stylesheet.xml http://www.biodas.org/documents/sample_stylesheet.xml].
+
; INT
 +
: An integer
 +
; FLOAT
 +
: A floating point number (not currently used)
 +
; STRING
 +
: A text string
 +
; COLOR
 +
: A color. Colors can be specified using the "#RRGGBB" format commonly used in HTML, or as one of the 16 IBM VGA colors recognized by Netscape and Internet Explorer. <font color="blue">Ensembl supports more than that...</font>
 +
; BOOL
 +
: A boolean value, either "yes" or "no".
 +
; FONT
 +
: A font. Any of the font identifiers recognized by Web browsers is acceptable, e.g. "helvetica".
 +
; FONT_STYLE
 +
: One of "bold", "italic", "underline".
 +
; LINE_STYLE
 +
: One of "hat", "solid", "dashed".
  
===Glyphs and Groups===
+
Some attributes are shared by all glyphs. Others are glyph-specific. The following attributes are shared in common:
  
Glyphs and their attributes are typically applied to individual features. However, they can be applied to entire groups as well (via the <GROUP> '''type''' attribute). In this case, the glyph will apply to the connecting regions '''between''' the components of the group.
+
; HEIGHT
 +
: type: INT
 +
: The height of the glyph, in pixels. For the text font, this is equivalent to the FONTSIZE attribute.
 +
; FGCOLOR
 +
: type: COLOR
 +
: The foreground color of the glyph. This is the line and outline color for graphical glyphs, and the font color for text glyphs.
 +
; BGCOLOR
 +
: type: COLOR
 +
: The background color of the glyph. For hollow glyphs, such as boxes, this is the color of the interior of the box. For solid glyphs, such as text, this is ignored
 +
; LABEL
 +
: BOOL
 +
: Whether the glyph should be labeled with its name, as dictated by the <FEATURE> '''label''' attribute in the DASGFF document.
 +
; BUMP
 +
: BOOL
 +
: Whether the glyph should "bump" intersecting glyphs so that they do not overlap.
 +
 
 +
'''<em>ARROW</em>'''
 +
 
 +
A double-headed arrow with an axis either orthogonal or parallel to the sequence map.
 +
 
 +
Attributes:
 +
 
 +
; PARALLEL
 +
: type: BOOL
 +
: Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.
 +
 
 +
'''<em>ANCHORED_ARROW</em>'''
 +
 
 +
An arrow that has an arrowhead at one end, and an "anchor" (typically a diamond or line) at the other. The arrow points in the direction indicated by the <ORIENTATION> tag.
 +
 
 +
Attributes:
 +
 
 +
; PARALLEL
 +
: type: BOOL
 +
: Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.
 +
 
 +
'''<em>BOX</em>'''
 +
 
 +
A rectangular box.
 +
 
 +
Attributes:
 +
 
 +
; LINEWIDTH
 +
: type: INT
 +
: Width of the box outline.
 +
 
 +
'''<em>CROSS</em>'''
 +
 
 +
A cross "+". Common used for point mutations and other point-like features.
 +
 
 +
Attributes:
 +
 
 +
(no glyph-specific attributes)
 +
 
 +
'''<em>DOT</em>'''
 +
 
 +
A dot. Common used for point mutations and other point-like features.
 +
 
 +
Attributes:
 +
 
 +
(no glyph-specific attributes)
 +
 
 +
'''<em>EX</em>'''
 +
 
 +
"X" marks the spot. Common used for point mutations and other point-like features.
 +
 
 +
Attributes:
 +
 
 +
(no glyph-specific attributes)
 +
 
 +
'''<em>HIDDEN</em>'''
 +
 
 +
A feature that is invisible, intended to support semantic zooming schemes in which a feature is hidden at particular zooms.
 +
 
 +
Attributes: none.
 +
 
 +
'''<em>LINE</em>'''
 +
 
 +
A line. Lines are equivalent to arrows with both the <em>northeast</em> and <em>southwest</em> attributes set to "no".
 +
 
 +
Attributes:
 +
 
 +
; STYLE
 +
: type: LINE_STYLE
 +
: The line type. A type of "hat" draws an inverted V (commonly used for introns). A type of "solid" draws a horizontal solid line in the indicated color. A type of "dashed" draws a dashed horizonal line in the indicated color.
 +
 
 +
'''<em>SPAN</em>'''
 +
 
 +
A spanning region, the recommended representation is a horizontal line with vertical lines at each end.
 +
 
 +
Attributes:
 +
 
 +
(no glyph-specific attributes)
 +
 
 +
'''<em>TEXT</em>'''
 +
 
 +
A bit of text.
 +
 
 +
Attributes:
 +
 
 +
; FONT
 +
: type: FONT
 +
: The font.
 +
; FONTSIZE
 +
: type: INT
 +
: The font size.
 +
; STRING
 +
: type: STRING
 +
: The text to render.
 +
; STYLE
 +
: type: FONT_SYTLE
 +
: The style in which to render this glyph. Multiple FONT_STYLE attributes may be present.
 +
 
 +
'''<em>PRIMERS</em>'''
 +
 
 +
Two inward-pointing arrows connected by a line of a different color. Used for showing primer pairs and a PCR product. The length of the arrows is meaningless.
 +
 
 +
There are no glyph-specific attributes, but in this context the foreground color is the color of the arrows, and the background color is the color of the line that connects them.
 +
 
 +
'''<em>TOOMANY</em>'''
 +
 
 +
Too many features than can be shown. Recommended for use in consolidating sequence homology hits. The recommended visual presentation is a set of overlapping boxes.
 +
 
 +
Attributes:
 +
 
 +
; LINEWIDTH
 +
: type: INT
 +
: Width of the glyph.
 +
 
 +
'''<em>TRIANGLE</em>'''
 +
 
 +
A triangle. Commonly used for point mutations and other point-like features. The triangle is always drawn in the center of its range, but its width and height can be controlled by HEIGHT and LINEWIDTH respectively.
 +
 
 +
Attributes:
 +
 
 +
; LINEWIDTH
 +
: type: INT
 +
: Width of the glyph.
 +
; DIRECTION
 +
: One of "N", "E", "S", and "W"
 +
 
 +
----
 +
 
 +
====Glyphs and Groups====
 +
 
 +
Glyphs and their attributes are typically applied to individual features. However, they can be applied to entire groups as well (via the <GROUP> '''type''' attribute). In this case, the glyph will apply to the connecting regions '''between''' the <font color="blue">individual features within the group. Glyphs for groups are identified in the stylesheet using the special category named "group".</font>
  
 
For example, to indicate that the exons in a "transcript" group should be drawn with a yellow box, that the utrs should be drawn with a blue box, and that the connections between exons should be drawn with a hat-shaped line:
 
For example, to indicate that the exons in a "transcript" group should be drawn with a yellow box, that the utrs should be drawn with a blue box, and that the connections between exons should be drawn with a hat-shaped line:
  
 +
<font color="blue">Note that these terms aren't in the BS ontology because it is still protein-specific!</font>
 +
 +
<CATEGORY id="inferred from electronic annotation (ECO:00000067)">
 
   
 
   
<CATEGORY id="Transcription">
+
    <TYPE id="SO:0000147"> <!-- exon -->
    <TYPE id="exon">
 
 
       <GLYPH>
 
       <GLYPH>
 
           <BOX>
 
           <BOX>
 
             <BGCOLOR>yellow</BGCOLOR>
 
             <BGCOLOR>yellow</BGCOLOR>
 
 
           </BOX>
 
           </BOX>
 
       </GLYPH>
 
       </GLYPH>
 
     </TYPE>
 
     </TYPE>
 
   
 
   
     <TYPE id="utr">
+
     <TYPE id="SO:0000203"> <!-- UTR -->
 
       <GLYPH>
 
       <GLYPH>
 
           <BOX>
 
           <BOX>
 
 
             <BGCOLOR>blue</BGCOLOR>
 
             <BGCOLOR>blue</BGCOLOR>
 
           </BOX>
 
           </BOX>
 
       </GLYPH>
 
       </GLYPH>
 
     </TYPE>
 
     </TYPE>
 +
 
  </CATEGORY>
 
  </CATEGORY>
 
   
 
   
 
  <CATEGORY id="group">
 
  <CATEGORY id="group">
<TYPE id="transcript">
 
    <GLYPH>
 
      <LINE>
 
          <FGCOLOR>black</FGCOLOR>
 
          <LINE_STYLE>hat</LINE_STYLE>
 
 
   
 
   
       </LINE>
+
    <TYPE id="SO:0000673"> <!-- transcript -->
    </GLYPH>
+
       <GLYPH>
</TYPE>
+
          <LINE>
  ...
+
            <FGCOLOR>black</FGCOLOR>
 +
            <LINE_STYLE>hat</LINE_STYLE>
 +
          </LINE>
 +
      </GLYPH>
 +
    </TYPE>
 +
 
 +
  </CATEGORY>
  
 
----
 
----
  
==Fetching Sequence Assemblies<font color="red"> We are proposing to deprecate this as not many people use it????==
+
==Fetching Sequence Assemblies==
 +
 
 +
<font color="red"> We are proposing to deprecate this as not many people use it.
  
 
Reference servers, but not annotation servers, must represent and serve genome assemblies.
 
Reference servers, but not annotation servers, must represent and serve genome assemblies.
Line 1,184: Line 1,352:
  
 
<code>
 
<code>
 
 
   
 
   
 
  http://www.wormbase.org/db/das/elegans/features?segment=chr22:1,1000;category=component
 
  http://www.wormbase.org/db/das/elegans/features?segment=chr22:1,1000;category=component
Line 1,278: Line 1,445:
  
 
To continue following the parents upward in the assembly, the client will issue further features requests for the target IDs, in this case "contig21" and "contig100". In the general case, following parents will project the requested segment onto a discontinuous set of regions, potentially on different chromosomes. The client may wish to alert the user and refuse to proceed further when it encounters a segment with multiple parents.
 
To continue following the parents upward in the assembly, the client will issue further features requests for the target IDs, in this case "contig21" and "contig100". In the general case, following parents will project the requested segment onto a discontinuous set of regions, potentially on different chromosomes. The client may wish to alert the user and refuse to proceed further when it encounters a segment with multiple parents.
 
+
</font>
 
----
 
----
  
 
==Feature Types and Categories==
 
==Feature Types and Categories==
 +
 +
Annotations returned by the ''features'' command are classified by type. Specifically, the type refers to the class of data represented by the annotation. Previous versions of this specification gave guidelines for the content (or semantics) of a feature's type, but as of version 1.6 DAS has formally adopted the use of ontologies for this purpose.
 +
 +
The '''type''' of an annotation is selected from one of the following ontologies:
 +
 +
{| border="border"
 +
|-
 +
! Ontology name
 +
! Ontology ID
 +
|-
 +
| Sequence Types and Features
 +
| SO
 +
|-
 +
| Protein Modifications (PSI-MOD)
 +
| MOD
 +
|-
 +
| BioSapiens Annotations
 +
| BS
 +
|}
 +
 +
The type is further classified by '''category'''. The category is a classification of how the annotation was derived, represented as ''evidence'':
 +
 +
{| border="border"
 +
|-
 +
! Ontology name
 +
! Ontology ID
 +
|-
 +
| Evidence Codes
 +
| ECO
 +
|}
 +
 +
All ontologies can be browsed and searched using the [http://www.ebi.ac.uk/ontology-lookup/ Ontology Lookup Service] at the European Bioinformatics Institute.
 +
 +
These ontologies are applied to the DAS ''features'' response in the following manner:
 +
 +
===Type ID===
 +
 +
The ID attribute of the <TYPE> element is the ontology term ID. For example:
 +
 +
<code>
 +
 +
<TYPE '''id="SO:0000114"''' ... > ... </TYPE>
 +
 +
</code>
 +
 +
===Type label===
 +
 +
The content of the <TYPE> element is the ontology term name. For example:
 +
 +
<code>
 +
 +
<TYPE id="SO:0000114"  ... >'''methylated_C'''</TYPE>
 +
 +
</code>
 +
 +
===Type category===
 +
 +
The category attribute of the <TYPE> element is the evidence term name, followed by the evidence term ID in parentheses. For example:
 +
 +
<code>
 +
 +
<TYPE id="SO:0000114"  '''category="inferred from experiment (ECO:0000006)"'''>methylated_C</TYPE>
 +
 +
</code>
 +
 +
<font color="blue">The following is DEPRECATED:
  
 
This is a list of generic feature categories and specific feature types within them. This list was derived from the features currently exported by ACeDB/GFF and is not comprehensive. Suggestions for modifications, additions and deletions are welcomed.
 
This is a list of generic feature categories and specific feature types within them. This list was derived from the features currently exported by ACeDB/GFF and is not comprehensive. Suggestions for modifications, additions and deletions are welcomed.
  
===<em>component</em>===
+
'''<em>component</em>'''
  
 
This category indicates that the feature is a child component of the reference sequence in the current assembly. When combined with the '''reference="yes"''' attribute, this indicates that the feature can be used as a reference point to retrieve subfeatures contained within it (including subcomponents).
 
This category indicates that the feature is a child component of the reference sequence in the current assembly. When combined with the '''reference="yes"''' attribute, this indicates that the feature can be used as a reference point to retrieve subfeatures contained within it (including subcomponents).
  
===<em>supercomponent</em>===
+
'''<em>supercomponent</em>'''
  
 
This category indicates that the feature is the parent of the reference sequence in the current assembly. When combined with the '''reference="yes"''' attribute, this indicates that the feature can be used as a reference point to retrieve features that completely contain the selected range of the reference sequence.
 
This category indicates that the feature is the parent of the reference sequence in the current assembly. When combined with the '''reference="yes"''' attribute, this indicates that the feature can be used as a reference point to retrieve features that completely contain the selected range of the reference sequence.
  
===<em>translation</em>===
+
'''<em>translation</em>'''
  
 
The <em>translation</em> category is used for features that relate to regions of the sequence that are translated into proteins. Features that relate to transcription are separate (see below).
 
The <em>translation</em> category is used for features that relate to regions of the sequence that are translated into proteins. Features that relate to transcription are separate (see below).
Line 1,308: Line 1,541:
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.
  
===<em>transcription</em>===
+
'''<em>transcription</em>'''
  
 
The <em>transcription</em> category is used for features that relate to regions of the sequence that are transcribed into RNA.
 
The <em>transcription</em> category is used for features that relate to regions of the sequence that are transcribed into RNA.
Line 1,327: Line 1,560:
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.
  
===<em>variation</em>===
+
'''<em>variation</em>'''
  
 
The <em>variation</em> category is used for features that relate to regions of the sequence that are polymorphic.
 
The <em>variation</em> category is used for features that relate to regions of the sequence that are polymorphic.
Line 1,340: Line 1,573:
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the variation.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the variation.
  
===<em>structural</em>===
+
'''<em>structural</em>'''
  
 
The <em>structural</em> category is used for features that relate to mapping, sequencing and assembly, as well as for various landmarks that carry no intrinsic biological information.
 
The <em>structural</em> category is used for features that relate to mapping, sequencing and assembly, as well as for various landmarks that carry no intrinsic biological information.
Line 1,355: Line 1,588:
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the structural feature.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the structural feature.
  
===<em>similarity</em>===
+
'''<em>similarity</em>'''
  
 
The <em>similarity</em> category is used for areas that are similar to other sequences. Similarity features should have a <METHOD> tag that indicates the algorithm used for the sequence comparison, and a <TARGET> tag that indicates the target of the match.
 
The <em>similarity</em> category is used for areas that are similar to other sequences. Similarity features should have a <METHOD> tag that indicates the algorithm used for the sequence comparison, and a <TARGET> tag that indicates the target of the match.
Line 1,367: Line 1,600:
 
* misc_homology
 
* misc_homology
  
===<em>repeat</em>===
+
'''<em>repeat</em>'''
  
 
The <em>repeat</em> category is used for areas that contain repetitive DNA. This category is used both for low-complexity regions, such as microsatellites, and for more biologically interesting features, such as transposon insertion sites.
 
The <em>repeat</em> category is used for areas that contain repetitive DNA. This category is used both for low-complexity regions, such as microsatellites, and for more biologically interesting features, such as transposon insertion sites.
Line 1,382: Line 1,615:
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the repetitive element.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the repetitive element.
  
===<em>experimental</em>===
+
'''<em>experimental</em>'''
  
 
The <em>experimental</em> category is a catchall used to flag areas where there is interesting experimental data of one sort or another. It is intended for use with high-throughput functional genomics work, such as knockouts or insertional mutagenesis screens.
 
The <em>experimental</em> category is a catchall used to flag areas where there is interesting experimental data of one sort or another. It is intended for use with high-throughput functional genomics work, such as knockouts or insertional mutagenesis screens.
Line 1,397: Line 1,630:
  
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the nature of the experimental data.
 
It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the nature of the experimental data.
 
+
</font>
----
 
 
 
==Glyph Types==
 
 
 
This section describes a set of generic "glyphs" that can be used by sequence display programs to display the position of features on a sequence map. The annotation server may use these glyphs to send display suggestions to the viewer via the [#stylesheet stylesheet document].
 
 
 
The current set of glyph ID values are:
 
 
 
* ARROW
 
* ANCHORED_ARROW
 
* BOX
 
* CROSS
 
* EX
 
* HIDDEN
 
* LINE
 
* SPAN
 
* TEXT
 
* TOOMANY
 
* TRIANGLE
 
* PRIMERS
 
 
 
Each glyph has a set of attributes associated with it. Attribute values come in the following flavors:
 
 
 
; INT
 
: An integer
 
; FLOAT
 
: A floating point number (not currently used)
 
; STRING
 
: A text string
 
; COLOR
 
: A color. Colors can be specified using the "#RRGGBB" format commonly used in HTML, or as one of the 16 IBM VGA colors recognized by Netscape and Internet Explorer.
 
; BOOL
 
: A boolean value, either "yes" or "no".
 
; FONT
 
: A font. Any of the font identifiers recognized by Web browsers is acceptable, e.g. "helvetica".
 
; FONT_STYLE
 
: One of "bold", "italic", "underline".
 
; LINE_STYLE
 
: One of "hat", "solid", "dashed".
 
 
 
Some attributes are shared by all glyphs. Others are glyph-specific. The following attributes are shared in common:
 
 
 
; HEIGHT
 
: type: INT
 
: The height of the glyph, in pixels. For the text font, this is equivalent to the FONTSIZE attribute.
 
; FGCOLOR
 
: type: COLOR
 
: The foreground color of the glyph. This is the line and outline color for graphical glyphs, and the font color for text glyphs.
 
; BGCOLOR
 
: type: COLOR
 
: The background color of the glyph. For hollow glyphs, such as boxes, this is the color of the interior of the box. For solid glyphs, such as text, this is ignored
 
; LABEL
 
: BOOL
 
: Whether the glyph should be labeled with its name, as dictated by the <FEATURE> '''label''' attribute in the DASGFF document.
 
; BUMP
 
: BOOL
 
: Whether the glyph should "bump" intersecting glyphs so that they do not overlap.
 
 
 
===<em>ARROW</em>===
 
 
 
A double-headed arrow with an axis either orthogonal or parallel to the sequence map.
 
 
 
Attributes:
 
 
 
; PARALLEL
 
: type: BOOL
 
: Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.
 
 
 
===<em>ANCHORED_ARROW</em>===
 
 
 
An arrow that has an arrowhead at one end, and an "anchor" (typically a diamond or line) at the other. The arrow points in the direction indicated by the <ORIENTATION> tag.
 
 
 
Attributes:
 
 
 
; PARALLEL
 
: type: BOOL
 
: Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.
 
 
 
===<em>BOX</em>===
 
 
 
A rectangular box.
 
 
 
Attributes:
 
 
 
; LINEWIDTH
 
: type: INT
 
: Width of the box outline.
 
 
 
===<em>CROSS</em>===
 
 
 
A cross "+". Common used for point mutations and other point-like features.
 
 
 
Attributes:
 
 
 
(no glyph-specific attributes)
 
 
 
===<em>DOT</em>===
 
 
 
A dot. Common used for point mutations and other point-like features.
 
 
 
Attributes:
 
 
 
(no glyph-specific attributes)
 
 
 
===<em>EX</em>===
 
 
 
"X" marks the spot. Common used for point mutations and other point-like features.
 
 
 
Attributes:
 
 
 
(no glyph-specific attributes)
 
 
 
===<em>HIDDEN</em>===
 
 
 
A feature that is invisible, intended to support semantic zooming schemes in which a feature is hidden at particular zooms.
 
 
 
Attributes: none.
 
 
 
===<em>LINE</em>===
 
 
 
A line. Lines are equivalent to arrows with both the <em>northeast</em> and <em>southwest</em> attributes set to "no".
 
 
 
Attributes:
 
 
 
; STYLE
 
: type: LINE_STYLE
 
: The line type. A type of "hat" draws an inverted V (commonly used for introns). A type of "solid" draws a horizontal solid line in the indicated color. A type of "dashed" draws a dashed horizonal line in the indicated color.
 
 
 
===<em>SPAN</em>===
 
 
 
A spanning region, the recommended representation is a horizontal line with vertical lines at each end.
 
 
 
Attributes:
 
 
 
(no glyph-specific attributes)
 
 
 
===<em>TEXT</em>===
 
 
 
A bit of text.
 
 
 
Attributes:
 
 
 
; FONT
 
: type: FONT
 
: The font.
 
; FONTSIZE
 
: type: INT
 
: The font size.
 
; STRING
 
: type: STRING
 
: The text to render.
 
; STYLE
 
: type: FONT_SYTLE
 
: The style in which to render this glyph. Multiple FONT_STYLE attributes may be present.
 
 
 
===<em>PRIMERS</em>===
 
 
 
Two inward-pointing arrows connected by a line of a different color. Used for showing primer pairs and a PCR product. The length of the arrows is meaningless.
 
 
 
There are no glyph-specific attributes, but in this context the foreground color is the color of the arrows, and the background color is the color of the line that connects them.
 
 
 
===<em>TOOMANY</em>===
 
 
 
Too many features than can be shown. Recommended for use in consolidating sequence homology hits. The recommended visual presentation is a set of overlapping boxes.
 
 
 
Attributes:
 
 
 
; LINEWIDTH
 
: type: INT
 
: Width of the glyph.
 
 
 
===<em>TRIANGLE</em>===
 
 
 
A triangle. Commonly used for point mutations and other point-like features. The triangle is always drawn in the center of its range, but its width and height can be controlled by HEIGHT and LINEWIDTH respectively.
 
 
 
Attributes:
 
 
 
; LINEWIDTH
 
: type: INT
 
: Width of the glyph.
 
; DIRECTION
 
: One of "N", "E", "S", and "W"
 
  
 
----
 
----
Line 1,589: Line 1,640:
 
==Changes==
 
==Changes==
  
This section was added at version 0.99.
 
 
===Version 1.51===
 
 
# The description of the entry_points document was out of synch with the DTD. Also there seems to have been some semantic drift between Dazzle, the UCSC server, and LDAS with regards to the attributes of the <SEGMENT> tag. This has now been made explicit, and the DTD relaxed to allow all styles.
 
 
===Version 1.5===
 
 
# Added capabilities header.
 
# Added exception handling for invalid sequence IDs.
 
# Added feature_id request.
 
# Corrected syntax errors in stylesheet example.
 
 
===Version 1.01===
 
 
# Split assembly functionality into "component" and "supercomponent".
 
# Removed redundant descriptions of glyph attributes.
 
 
===Version 1.0===
 
 
# Removed deprecated ''resolve'' command.
 
# Removed deprecated ''entry_points'' '''ref''' argument.
 
# Added '''superparts''' attribute to DASGFF <FEATURE> tag.
 
# New discussion of how to move upwards in an assembly.
 
# Reorganized specification to put responses close to requests.
 
# Added a stylesheet example document.
 
# Normalized the names of glyph COLOR and FILLCOLOR attributes to FGCOLOR and BGCOLOR.
 
# Added the LABEL attribute to all glyphs.
 
# Added the STYLE attribute to the LINE glyph.
 
# Added the ability to assign a glyph to a group.
 
# Added HIDDEN glyph.
 
 
===Version 0.999===
 
 
# Added LINK, NOTE, and TARGET to FEATURE
 
# Added section entitled "Fetching Sequence Assemblies"
 
 
===Version 0.998===
 
 
# Deprecated regular expression matching for types and categories.
 
# Allow multiple TYPE arguments for logical OR filtering.
 
# Made FEATURE optional within features return document.
 
# Made TYPE optional within types return document.
 
 
===Version 0.996===
 
 
# Added subparts tag to features and entry_points.
 
# Removed the requirement that the server return features that do not overlap with the requested segment.
 
# Added support for multiple segments/sequences in types document.
 
 
===Version 0.995===
 
 
# Added support for multiple segments/sequences in returned documents.
 
# Added support for assembly components.
 
 
===Version 0.99===
 
 
# Allow query parameters to be POSTed to the DAS URL.
 
# Added compatibility warning about SOAP conversion.
 
# Use Version 8 regular expressions rather than GNU's, giving compatibility with both Perl regex and GNU regex.
 
# Made the '''id''' attribute of the <TYPE> tag required.
 
# Changed the WIDTH glyph attribute to HEIGHT throughout.
 
 
----
 
Lincoln D. Stein, lstein@cshl.org<br />[http://www.cshl.org/ Cold Spring Harbor Laboratory]
 
  
Last modified: Thu May 22 12:55:39 EDT 2003
+
Last modified: 08 Oct 2008

Latest revision as of 14:23, 30 October 2008

Note: this is NOT the official version of the DAS specification.

Distributed Sequence Annotation System (DAS) Spec Review

Oct 1,2008

This is a working document and a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the 1.53E spec and some of the 2.0 spec. Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as protein sequences and structures. The spec also includes references to the DAS Registry which is essential for implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures. Note that we are proposing to change dtd for xsd

System Architecture

The Distributed Annotation System is a network of server and client software installations distributed across the web. The DAS protocol is a standard mechanism through which clients can communicate with servers in order to obtain various types of biological data. The protocol defines:

  • the communication method
  • the query model
  • the data format

By enforcing these constraints, DAS allows a client to integrate data from many diverse sources implementing the protocol at a scaleable development cost.

The DAS network of servers comprises a registry, several reference servers and several annotation servers. Tying these together are the concepts of reference objects and coordinate systems.

Reference Objects

Reference objects are items of data with stable identifiers that are targets for annotation. At the most abstract level a reference object might be an annotatable concept or idea (e.g. a particular gene), but usually describes a biological unit within which annotations can be positioned. For example, "P15056" refers to a protein sequence upon which annotations can be based. Similarly, "chromosome 21" refers to a DNA sequence.

Individual reference objects can in fact have several versions, and it is important to recognise that annotations based upon different versions of the same reference entity are not necessarily equivalent.

Annotations

Annotations are pieces of information that are always attributed to a reference object. Annotations are usually positional, that is they refer to a specific location within a reference object. An exon within a genomic sequence is an example. Annotations can also be non-positional, in which case they can be considered as information attributed to the whole of the reference object. For example, the description of a protein or gene.

Coordinate Systems

A coordinate system is a stable, logical set of reference objects. A coordinate system provides a mechanism to uniquely identify reference objects that share identifiers, such as chromosomes. For example, chromosome 21 might identify several reference objects from different species', but only one within the NCBI 36 human assembly. Thus, "human NCBI 36 chromosomes" is a coordinate system containing 25 reference objects.

Coordinate systems are formally described using four properties:

  • The category or type of annotatable entity. For example a chromosome, contig or protein sequence
  • The authority responsible for defining the coordinate system. For example NCBI or UniProt
  • The version, for coordinate systems containing entities that are not versioned (e.g. genomic assemblies)
  • The species, for coordinate systems containing only entities from a single organism

Of these, category and authority are required.

Some example coordinate systems:

Category Authority Version Species
Chromosome NCBI 36 Homo sapiens
Scaffold ZFISH 7 Danio rerio
Protein sequence UniProt - -

Reference & Annotation Servers

A reference server is a DAS server that provides core data for the reference objects in a particular coordinate system. For example, the reference server for "UniProt Protein sequence" provides the actual sequence for each UniProt entry. It does this by implementing the DAS sequence command. So that clients can discover the available reference objects in a coordinate system, a reference server must also list them via the entry_points command.

Annotation servers are specialized for returning lists of annotations for the reference objects within a coordinate system. This is done by implementing the DAS features command.

In future versions of the spec (i.e. those not focussed entirely on sequence) this will be generalised. That is, reference objects won't be assumed to be sequences and annotations won't be assumed to be sequence features.

Note: The distinction between reference and annotation servers is conceptual rather than physical. That is, a single server instance can in fact play both roles by offering both sequences and annotations of those sequences.

Note: A server may support multiple coordinate systems.

The DAS Registry

The DAS registry is a special component of DAS, fulfilling the following roles:

  1. Catalogues and describes the capabilities and coordinate systems of DAS services
  2. Allows discovery of available DAS services via both human and programmatic interfaces
  3. Automatically validates registered DAS sources to ensure that they correctly implement the protocol
  4. Periodically tests DAS sources and notifies their administrators if they are unavailable
  5. Provides a mechanism for activating or highlighting individual DAS services in clients

a list of cmds that you can perform on the registry such as /das1/sources and http://www.dasregistry.org/das/coordinatesystem can be found here http://www.dasregistry.org/help_scripting.jsp#coordinatesystem

Clients

A DAS client typically integrates data from a number of DAS servers, making use of the different data types. For example, a client might implement the following procedure for a particular sequence location:

  1. Contact DAS registry to find reference and annotation servers for a particular genomic assembly
  2. Obtain sequence from the reference server
  3. Obtain sequence features from each of the annotation servers
  4. Display the annotations in the context of the sequence

See this example in diagrammatic form: PNG image

Client/Server Interactions

The DAS is web-based. Clients query the reference and annotation servers using the HTTP protocol (see RFC2616) by sending a formatted URL request to the server. Servers process the request and return a response in the form of a formatted XML document (see W3C Extensible Markup Language) according to a predefined schema.

The Request

All DAS requests take the form of a hierarchical URL. Each URL has a site-specific prefix, followed by a standardized path and query string. The standardized path begins with the string /das. This is followed by URL components containing the data source name and a command. Should put some guidance or specify the ability for servers to accept encoded URLs For example: How do we get everyone to specify say "chromosome1" in the exact same way not "chr1" etc. By coordinate system and entry_points I guess. Reference server MUST implement entry_points, regardless of number of objects (don't expect it to come back quickly). We can always add a "range" parameter later


http://das.sanger.ac.uk/das/ccds_mouse/features?segment=1:174405453,174408689
^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  site-specific prefix  das  data src  command   arguments

In this case, the site-specific prefix is http://das.sanger.ac.uk. The request begins with the standardized path /das, and the data source, in this case /ccds_mouse. This is followed by the command /features, which requests a list of features, and a query string providing named arguments to the /features command.

Thus, a single DAS server hosts one or more DAS sources, allowing it to provide different types of information, and/or information in several coordinate systems. This example source provides consensus CDS transcripts for mouse chromosomes, but the same server provides a number of other sources, including a similar source for human along with sources containing very different types of data.

More information on the format of the request and the various available commands is given [#commands below].

The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.

DELETE: The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.

The Response

The response from the server to the client consists of a standard HTTP header with DAS status information within that header, followed optionally by XML content that contains the answer to the query. The DAS status portion of the header consists of three lines. The first is X-DAS-Version and gives the current protocol version number, currently DAS/1.6. The second line is X-DAS-Status and contains a three digit status code which indicates the outcome of the request. The third is X-DAS-Capabilities, which describes the parts of of the spec the server implements.

Here is an example HTTP header: (provided by Web server)


HTTP/1.1 200 OK                          
Date: Sun, 12 Mar 2000 16:13:51 GMT          
Server: Apache/1.3.6 (Unix) mod_perl/1.19    
Last-Modified: Fri, 18 Feb 2000 20:57:52 GMT 
Connection: close                            
Content-Type: text/plain                     
X-DAS-Version: DAS/1.6
X-DAS-Status: 200
X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
data follows...

The defined status codes are listed in Table 1.

Table 1: DAS response codes
200 OK, data follows
400 Bad command (command not recognized)
401 Bad data source (data source unknown)
402 Bad command arguments (arguments invalid)
403 Bad reference object (reference sequence unknown)
404 Bad stylesheet (requested stylesheet unknown)
405 Coordinate error (sequence coordinate is out of bounds/invalid)
500 Server error, not otherwise specified
501 Unimplemented feature

The HTTP/1.0 protocol allows web clients to request byte-level compression of the response by sending the HTTP header Accept-Encoding header. Web servers that are capable of it can reply with a Content-transfer-encoding header and a compressed body. Implementors of DAS clients and servers may wish to implement this HTTP feature.

X-DAS-Capabilities

The X-Das-Capabilities header provides an extensible list of the capabilities that the server provides. This can be used by clients wishing to make use of optional components of the DAS protocol where they are supported, and by those writing experimental extensions to DAS to flag clients that those extensions are available. Capabilities have the form CapabilityName/Version and are separated by semicolon, space, as in "capabilityA/1.0; capabilityB/1.4; capabilityC/1.0". The following standard capabilities are present in the DAS/1.6 protocol:

Capability Name Description
dsn/1.0 Deprecate these: The server supports the deprecated dsn request.
dna/1.0 The server supports the deprecated dna request.
types/1.0 The server supports the basic types request.
stylesheet/1.1 The server supports the basic stylesheet request.
features/1.0 The server supports the basic features request.
entry_points/1.0 The server supports the basic entry_points request.
error-segment/1.0 Server will report requests for invalid segments with an <ErrorSegment> response.
unknown-segment/1.0 Server will report requests for unknown or unannotated segments with an <UnknownSegment> response.
unknown-feature/1.0 Server will report requests for unknown features with an <UnknownFeature> response.
feature-by-id/1.0 The features request will accept the CGI parameter "feature_id", enabling the server to look up annotations based on their ID.
group-by-id/1.0 The features request will accept the CGI parameter "group_id", enabling the server to look up annotations based on the ID of a group.
component/1.0 Deprecate? The features request will return components of the indicated segment when a category type of "component" is requested.
supercomponent/1.0 Deprecate? The features request will return supercomponents of the indicated segment when a category type of "supercomponent" is requested.
sequence/1.0 The server supports the sequence request.

Reference Object IDs

The ID used by a client or server to refer to a reference object can contain any set of printable characters (including the space character), but not the colon character (":"), which is reserved for separating reference IDs from sequence ranges (see below). The newline, tab and carriage return characters are also reserved for future use.

A data source that uses the colon character for its internal IDs must map this character to another one on the way in and on the way out. For example:


   Client request       server's internal id         Response to client

   gi-123456       -->  gi:123456                    --->  gi-123456

   gi-123456:1,1000 --> gi:123456 start=1 stop=1000  --->  gi-123456:1,1000


In general, DAS mandates that a server must respond in the same coordinate system by which it is queried. This is relevant where annotations can potentially exist in several coordinate systems (such as clones and contigs).



The Queries

This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as PREFIX. The other meta-variable used in these examples is DSN, which is a symbolic data source (as seen in the [#request above example.])

At present, there is no implementation of the "assembly traversal' features of DAS. In the interests of simplicity, we could opt for removing this capacity. This would involve removing:

  • entry_points: subparts and orientation attributes (orientation only makes sense if you have other information about how entry points relate to each other)
  • features: reference, superparts and subparts attributes

Sources Command

Retrieve the list of data sources for a server.

DSN command has been deprecated in favour of this sources cmd

Scope: Reference and annotation servers.

Command: sources

Format:

PREFIX/das/sources

Description: This query returns the list of data sources that are available from this server. In particular the following information for a DAS server is important:

  • The email address of the maintainer of a DAS source
  • The coordinate system of the provided data
  • Different properties that allow further description of a source

Arguments: none

Response:

The response to the sources command is the "DASSSOURCE" XML-formatted document:

<?xml version='1.0' encoding='UTF-8' ?>
<?xml-stylesheet type="text/xsl" href="das.xsl"?>
<SOURCES>
 <SOURCE uri="URI" title="title" doc_href="URL" description="description">
    <MAINTAINER email="email address" />
    <VERSION uri="URI" created="date">
      <COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string</COORDINATES>      
      <CAPABILITY type="das1:command" query_uri="URL" />
      <PROP name="key" value="value" />     
     </VERSION>
   </SOURCE>
</SOURCES>

Format:

xml-stylesheet optional an XSL stylesheet that e.g. allows a browser to nicely display the XML response I'm not sure whether this should actually be part of the spec - could be confused with stylesheet command? We should probably highlight the fact that there is a difference and that this is for display in a web browser not how to display in a client.
SOURCES mandatory the main container for several DAS sources
SOURCE mandatory, one or many the description for a DAS datasource
uri mandatory a unique URI for the DAS source
title, description mandatory the nickname under which a DAS server shall be known and displayed in a view. The description is a free text description of the provided data
doc_href optional points to a web site where more information about a DAS source can get obtained.
MAINTAINER, email mandatory the email address of the maintainer of this DAS source.
VERSION mandatory in principle this would allow hosting several versions of a DAS sources (with unique URIs)

on a server, but in practise most people provide only the server with the latest data. Different versions of the same source should be considered to beequivalent, that is the latest version is definitive. The created attribute provides the date on which a DAS server has been set up initially. For a DAS registation server this is the date at which a DAS server has been pulished.

COORDINATES mandatory, one or many The description of the coordinate system(s) a DAS source operates on.

uri - the unique URI for a DAS coordinate system. For a DAS registration server these should be resolvable and allow to access more information. e.g. [1] for the UniProt,Protein Sequence coordinate system.

source - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available: Chromosome, Clone, Contig, Gene_ID, NT_Contig, Protein Sequence, Protein Structure

authority - the authority, or institution that assigns the accession code for this namespace. In case of genome assemblies the authority that builds the assembly.


version - (optional) for genome assemblies the version of the build.
To learn more about coordinate systems, please see <a href="help_coords.jsp">here</a>.

CAPABILTIY mandatory, one or many The supported DAS commmand

type - the type of the DAS command. to distinguish DAS/1 from DAS/2 servers das1: is used before the name of the command.
query_urithe URL of the server location, with the command attached. e.g. http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/features

Note: For some DAS commands this will not resolve, since e.g. for the features command the extension
/features?segment=ID
needs to be attached.
PROP optional, one or many a free key- value style property that allows to add more tags to a server

Example Responses




Entry Points Command

Retrieve the list of reference objects for a data source

This Entry_Points cmd is now mandatory for reference servers.

Scope: Reference servers.

Command: entry_points

Format:

PREFIX/das/DSN/entry_points

Description: This query returns the list of sequence entry points available and their sizes in base pairs.

Arguments:

ref (deprecated)
If a sequence reference ID is provided in the ref argument, the query will return the components of the sequence (its subsequences) rather than the list of top-level entry point sequences. This argument is DEPRECATED, and superseded by the "component" category of the features request.
type (deprecated)
For ACEDB servers, the type parameter provides the class of the reference sequence, Sequence by default. DEPRECATED

Response:

The response to the entry_points command is the "DASEP" XML-formatted document:

Format:

<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
<DASEP>
  <ENTRY_POINTS href="url" version="X.XX">
    <SEGMENT id="id1" start="start1" stop="stop1" type="type" is now deprecated due to the registry should specify the type in this coordinate system  orientation="+">descriptive text</SEGMENT>

    <SEGMENT id="id2" start="start2" stop="stop2" type="type" orientation="+">descriptive text</SEGMENT>
    <SEGMENT id="id3" start="start3" stop="stop3" type="type" orientation="+">descriptive text</SEGMENT>

    ...
  </ENTRY_POINTS>
</DASEP>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the entry_points query, the doctype DTD is "http://www.biodas.org/dtd/dasep.dtd".
<DASEP> (required, one only)
The appropriate doctype and root tag is DASEP.
<ENTRY_POINTS> (The start and stop are now optional, only one)
There is a single <ENTRY_POINTS> tag. It has a version number (required) in the form "N.NN". Whenever the DNA of the entry point changes, the version number should change as well. This is not implemented to my knowledge. Versioning is handled by coordinate systems, or explicitly for each segment. I suggest this be DEPRECATED. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (optional; zero or more)
Each segment contains the attributes id, start, stop and orientation. The id is a unique identifier, which can be used as the reference ID in further requests to DAS. The start and stop indicate the start and stop positions of the segment. Orientation is one of "+" or "-" and indicates the strandedness of the segment (use "+" if the segment is not intrinsically ordered)The orientation is now optional.. If the optional subparts attribute is present and has the value "yes", it indicates that the segment has subparts.The subparts section is now deprecated? The type section is now deprecated as this should be specified by the registry.For compatibility with older versions of the specification, the <SEGMENT> tag can use a size attribute rather than start and stop, and can omit the orientation attribute:
      <SEGMENT id="id" size="123456">
       In this case, the start is implied to be "1" and the stop is implied to be the same as the length.

Note: The result from the entry points requests does not carry sufficient information to reconstruct a complex sequence assembly. Instead, use the features request with a category of "component". See [#assemblies Fetching Sequence Assemblies].


DNA Command

Deprecated as the sequence cmd below is more commonly used.


Sequence Command

Retrieve all or part of the sequence for a reference object.

Scope: Reference servers.

Command: sequence

Format:

PREFIX/das/DSN/sequence?segment=RANGE[;segment=RANGE...]

Description: This query returns the sequence (nucleotide or protein) corresponding to the indicated segment.

Arguments:

segment (required; one or more)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. If the start and stop positions are not provided, then the entire reference sequence is returned.

Here is an example of a valid request that uses the segment argument to fetch three independent segments. The last segment is a subsequence:

    http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/sequence?
        segment=P00280;segment=P15056;segment=P51587:200,300

Response:

The response to sequence is the "DASSEQUENCE" XML-formatted document.

Format:

<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASSEQUENCE SYSTEM "http://www.biodas.org/dtd/dassequence.dtd">
<DASSEQUENCE>

  <SEQUENCE id="id" start="start" stop="stop">
               
      atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
      taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
      agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa
      taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa
      aaatgagaaaaatcgacgaaaatcggtataaaatcaaataaaaatagaaggaaaatattc
      agctcgtaaacccacacgtgcggcacggtttcgtgggcggggcgtctctgccgggaaaat
      tttgcgtttaaaaactcacatataggcatccaatggattttcggattttaaaaattaata
      taaaatcagggaaatttttttaaattttttcacatcgatattcggtatcaggggcaaaat
      tagagtcagaaacatatatttccccacaaactctactccccctttaaacaaagcaaagag
      cgatactcattgcctgtagcctctatattatgccttatgggaatgcatttgattgtttcc
      gcatattgtttacaaccatttatacaacatgtgacgtagacgcactgggcggttgtaaaa
      cctgacagaaagaattggtcccgtcatctactttctgattttttggaaaatatgtacaat
      gtcgtccagtattctattccttctcggcgatttggccaagttattcaaacacgtataaat
      aaaaatcaataaagctaggaaaatattttcagccatcacaaagtttcgtcagccttgtta
      tgtcaaccactttttatacaaattatataaccagaaatactattaaataagtatttgtat
      gaaacaatgaacactattataacattttcagaaaatgtagtatttaagcgaaggtagtgc
      acatcaaggccgtcaaacggaaaaatttttgcaagaatca
  </SEQUENCE>
</DASDNA>

<!DOCTYPE> (required; one only)
xsd instead of dtd.
<DASSEQUENCE> (required; one only)
The appropriate doctype and root tag is DASSEQUENCE.
<SEQUENCE> (required; one or more)
There is a single <SEQUENCES> tag per requested segment. It has the attributes id, which indicates the reference ID for this sequence, start and stop, which indicate the position of this segment within the reference sequence, Deprecate this as not consistent with registry and coordinate system? Yep moltype, which indicates the molecular type of the sequence, and version, which provides the version of the reference sequence. The molecule type is one of DNA, ssRNA, dsRNA, or Protein. No provision is made for circular molecules. The version may be either a numerical value or a digest such as MD5 checksum. All five attributes are required. The content of this tag is the sequence itself, using standard IUPAC codes for DNA, RNA and protein.

Types Command

Retrieve the types of features offered by a data source

how do we reconcile the way UCSC and ensembl uses the type command i.e. UCSC use it as a filter for tracks from one source, whereas ensembl only has one track per source!!! Can't deprecate this command as is used by UCSC??? Make the unit of registration in the registry the combination of the source and type(s), and we will make Ensembl will honour it and apply the filter.

Scope: Annotation and reference servers.

Command: types

Format:


PREFIX/das/DSN/types [?segment=RANGE]
                                   [;segment=RANGE]
                                   [;type=TYPE]
                                   [;type=TYPE]

Description: This query returns the annotation available for a segment of sequence.

Arguments:

segment (optional)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive.
type (optional)
I can't see that this is really needed. Deprecate? One or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be used.

If one or more segment arguments are provided, the list of types returned is restricted to the indicated segments. If no segment argument is provided, then all feature types known to the source are returned.

Response:

The document returned from the types request is an XML-formatted "DASTYPES" documents. This is a shortened form of the full features format (see below) and is used to summarize the type and number of each annotation. Annotation types can be grouped into segments, or be totaled across the entire database.


<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASTYPES SYSTEM "http://www.biodas.org/dtd/dastypes.dtd">

<DASTYPES>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

     <TYPE id="id1" DEPRECATED method="method" category="category">Type Count 1</TYPE>
     <TYPE id="id2" DEPRECATED method="method" category="category">Type Count 2</TYPE>

     ...
  </SEGMENT>
  </GFF>
</DASTYPES>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the types query, the doctype DTD is "http://www.biodas.org/dtd/dastypes.dtd".
<DASTYPES> (required; one only)
The appropriate doctype and root tag is DASTYPES.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment. The id, start and stop attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The version attribute (required) indicates the current version of the sequence map. The optional label attribute supplies a human readable label for display purposes. DEPRECATE: The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
<TYPE> (optional; zero or more per SEGMENT)
Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are id (required), category (required) and method (DEPRECATED - a method relates to a feature, not a type!). The content of these correspond to the equivalent values in the Features Command. The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.

Features Command

Retrieve the annotations for all or part of a reference object

Scope: Reference and annotation servers.

Command: features

Format:


PREFIX/das/DSN/features?segment=REF[:start,stop][;segment=REF:start,stop...]
                                      [;type=TYPE]
                                      [;type=TYPE]
                                      [;category=CATEGORY]
                                      [;category=CATEGORY]
                                      [;categorize=yes|no] deprecate...
                                      [;feature_id=ID]
                                      [;group_id=ID]

Description: This query returns the annotations across one or more segments of sequence.

Arguments:

segment (zero or more)
If specified, the segment argument restricts the list of annotations to those that overlap the indicated reference object, or a specific range within the reference object. The argument uses the format segment=reference or segment=reference:start,stop. Here, reference is the ID of the reference object used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. Multiple segments may be specified. For example: features?segment=REF1:100,200;segment=REF2
type (zero or more)
Zero or more type IDs to be used for filtering annotations on the type field. If multiple type IDs are provided, the resulting list of features will be the logical OR of the list. Remove this bit: For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on.
category (zero or more)
Zero or more category IDs to be used for filtering annotations by category. If multiple categories are provided, they are treated as the logical OR. Remove this bit: For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on.
categorize (optional)
Either "yes" or "no" (default). If "yes", then each annotation must include its functional category. This parameter is DEPRECATED. The category is now mandatory in the response.
feature_id (zero or more; new in 1.5)
Instead of, or in addition to, segment arguments, you may provide one or more feature_id arguments, whose values are the identifiers of particular features. If the server supports this operation, it will translate the feature ID into the segment(s) that strictly enclose them and return the result in the features response. It is possible for the server to return multiple segments if the requested feature is present in multiple locations. At the moment the few servers that implement this don't just use feature_id to identify the segment(s), they actually restrict on the feature ID... I'd say this behaviour is more valuable so perhaps we should specify it here. Likewise group_id below:
group_id (zero or more; new in 1.5)
The group_id argument, is similar to feature_id, but retrieves segments that contain the indicated feature group.

Servers may offer the same feature on several coordinate systems. In such a case, they will share a common feature ID and thus can be filtered by the client. Annotations must be returned using the coordinate system in which they were requested. For example, if a contig ID was used to specify the segment, then the annotation endpoints must use contig coordinates.

Servers should return annotations which overlap the segment, but are not completely contained within them. Annotation servers are no longer allowed to only return annotations which are completely contained within the indicated segment. This is confusing. Better as: Servers should return annotations which lie wholly or partially within the query segment. For example:

       -------------------
              Query       

-----   ---   -------    -----------   -----
  A      B       C            D          E  

In the above example, the server should return annotations B and C because they lie wholly within the query segment, and annotation D because it lies partially within the query segment.

If multiple segment arguments are provided and they happen to overlap, then the annotation server may return the same annotation multiple times, possibly using different coordinate systems. It is the responsibility of the client to merge annotations based on the assembly.

Response:

The document returned from the features request is an XML-formatted "DASGFF" document.

Format:


<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASGFF SYSTEM "http://www.biodas.org/dtd/dasgff.dtd">
<DASGFF>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

      <FEATURE id="id" label="label">
         <TYPE id="id" category="category" reference="yes|no">type label</TYPE>

         <METHOD id="id"> method label </METHOD>
         <START> start </START>
         <END> end </END>

         <SCORE> [X.XX|-] </SCORE>
         <ORIENTATION> [0|-|+] </ORIENTATION>
         <PHASE> [0|1|2|-]</PHASE>

         <NOTE> note text </NOTE>
	 <LINK href="url"> link text </LINK>
	 <TARGET id="id" start="x" stop="y">target name</TARGET>

	 <GROUP id="id" label="label" type="type">
	       <NOTE> note text </NOTE>
	       <LINK href="url"> link text </LINK>

	       <TARGET id="id" start="x" stop="y">target name</TARGET> DEPRECATED
         </GROUP>
      </FEATURE>
      ...
  </SEGMENT>
  </GFF>

</DASGFF>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the features query, the doctype DTD is "http://www.biodas.org/dtd/dasgff.dtd".
<DASGFF> (required; one only)
The appropriate doctype and root tag is DASGFF.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0 The href (required) attribute echoes the URL query that was used to fetch the current document. Not used - deprecate in favour of the capabilities headers and registry?
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment coordinate system. The id, start and stop attributes indicate the position of the segment. Since start and stop are no longer required query parameters, should they be optional in the response? The version attribute indicates the current version of the sequence map. The id, start, stop, and version attributes are required. The optional label attribute provides a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing. If anything the type should refer to the coordinate system IMO - deprecate or change?
<FEATURE> (optional; zero or more per SEGMENT)
There are zero or more <FEATURE> tags per <SEGMENT>, each providing information on one annotation. The id attribute (required) is a unique identifier for the feature. It can be used as a reference point for further navigation. The label attribute (optional) is a suggested label to display for the feature. If not present, the id attribute can be used instead.
<TYPE> (required; one per FEATURE)
Each feature has just one <TYPE> field, which indicates the type of the annotation. See the Feature Types and Categories section for details of what this tag should contain. HAVE REMOVED REFERENCE/SUBPARTS/SUPERPARTS ATTRIBUTES.
<METHOD> (required; one per FEATURE)
Each feature has one <METHOD> field, which identifies the method used to identify the feature, such as an experiment or algorithm. DELETE: The id (optional) tag can be used to retrieve further information from the annotation server. The tag contents (optional) is a human readable label.
<START>, <END> ( optional; one apiece per FEATURE)
These tags indicate the start and end of the feature in the coordinate system of the reference sequence given in the <SEGMENT> tag. The relationship between the feature start and stop positions and the segment start and stop is that the two spans are guaranteed to overlap wholly or partially. Non-positional features do not have a start or end.
<SCORE> ( optional; one per FEATURE)
This is a floating point number indicating the "score" of the method used to find the current feature. The number can only be understood in the context of information retrieved Replace with: "via the <LINK> element." from the server by linking to the method. If this field is inapplicable, the contents of the tag can be replaced with a - symbol. Omitting this element is equivalent to a value of -
<ORIENTATION> ( optional; one per FEATURE)
This tag indicates the orientation of the feature relative to the direction of transcription. It may be 0 for features that are unrelated to transcription, +, for features that are on the sense strand, and -, for features on the antisense strand. Omitting this element is equivalent to a value of 0.
<PHASE> ( optional; one per FEATURE)
This tag indicates the position of the feature relative to open reading frame, if any. It may be one of the integers 0, 1 or 2, corresponding to each of the three reading frames, or - if the feature is unrelated to a reading frame. Omitting this element is equivalent to a value of -.
<NOTE> (optional; zero or more per FEATURE)
A human-readable note in plain text format.
<LINK> (optional; zero or more per FEATURE)
A link to a web page somewhere that provides more information about this feature. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per FEATURE)
DEPRECATED The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. More information on the target can be retrieved by linking back to the annotation server. See [#feature_linking Linking to a Feature].
<GROUP> (optional; zero or more per FEATURE)
The <GROUP> section is slightly odd, as it is derived from an overloaded field in the GFF flat file format. It provides a unique "group" ID that indicates when certain features are related to each other. The canonical example is the CDS, exons and introns of a transcribed gene, which logically belong together. The group id attribute (required) provides an identifier that should be used by the client to group features together visually. Removing linking to features anyway... remove next sentence: Unlike other IDs in this protocol, the group ID cannot be used as a database handle to retrieve further information about the group. Such information can, however, be provided within <GROUP> section, which may contain up to three optional tags.The label attribute (optional) provides a human-readable string that can be used in graphical representations to label the glyph.The type attribute (optional) provides a type ID for the group as a whole, for example "transcript". This ID can be used as a key into the [#stylesheet stylesheet] to select the glyph and graphical characteristics for the group as a whole.
<NOTE> (optional; zero or more per GROUP)
A human-readable note in plain text format. Some sources embed HTML here e.g. arrayexpress... what do we do about these?
<LINK> (optional; zero or more per GROUP)
A link to a web page somewhere that provides more information about this group. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per GROUP)
DEPRECATED The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. NOTE: although this tag is present in the GROUP section, it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE> section. Earlier versions of this specification placed the TARGET tag in the GROUP section, and clients must recognize and accomodate this.

It is intended that annotation servers provide pointers to human-readable data that describes its features and methods in more detail.

Examples

<DASGFF>
   <GFF href="http://das.sanger.ac.uk/das/pfam/features">
      <SEGMENT id="P08487" version="d1dfb367c112d4820eeffe4eab1d6487" start="1" stop="1291">
         <FEATURE id="C2" label="C2:1090-1177">
            <TYPE id="SO:0000417" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_domain</TYPE>
            <START>1090</START>
            <END>1177</END>
            <METHOD id="Pfam">Pfam-A</METHOD>
            <SCORE>1.7e-18</SCORE>
            <NOTE>HMMER Version: 2.3.2</NOTE>
            <LINK href="http://pfam.sanger.ac.uk/family?entry=PF00168">C2</LINK>
         </FEATURE>
      </SEGMENT>
   </GFF>
</DASGFF>

Exception Handling for Invalid Segments

Rewritten this section, no longer "new"

A request for the sequence or annotations of a named segment may fail because either:

  1. the requested segment is outside the bounds of the reference object.
  2. the reference object is not known to the server

In both cases, an exception is indicated by issuing an <ERRORSEGMENT> or <UNKOWNSEGMENT> tag instead of the usual <SEGMENT> tag. In the case of a request for multiple segments, the server will return a mixture of <SEGMENT> sections for valid segments, and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for invalid ones:

<ERRORSEGMENT id="id" start="start" stop="stop">
<UNKNOWNSEGMENT id="id" start="start" stop="stop">
<SEGMENT id="id" start="start" stop="stop" version="version">
   ...
</SEGMENT>

The id attribute (required) corresponds to the ID of the requested segment, and start and stop (optional) correspond to the requested bounds of the segment (if this was specified).

An <UNKNOWNSEGMENT> exception will only be raised if:

  1. the reference object is not known to the server AND
  2. the server can not authoritatively identify that the requested segment is erroneous

Otherwise an <ERRORSEGMENT> exception is raised.

For example a reference server, which is authoritative for the coordinate system, knows that any reference object it cannot identify must be erroroneous. It will therefore raise an <ERRORSEGMENT>. By contrast an annotation server, which is not required to know the identities of all the reference objects in the coordinate system, should respond by issuing an <UNKNOWNSEGMENT> tag - it does not know whether the request is erroneous or not. All servers should issue <ERRORSEGMENT> exceptions when they detect a query segment that is beyond the range of a reference object.


Link command

Linking to a feature.

We are proposing to remove this command, as implementations tend to use a separate web server anyway

Scope: Annotation servers.

Command: link

Format:


PREFIX/das/DSN/link?field=TAG;id=ID

Description: This query can be issued in order to retrieve further human-readable information about an annotation. It is best to pass this URL directly to a browser, as the type of the returned data is not specified (it will typically be an HTML file, but any MIME format is allowed).

Arguments:

field (required)
The field to fetch further information on. Options are:
  • feature -- the feature itself
  • type -- the feature type
  • method -- the feature method
  • category -- the feature category
  • target -- the target, applicable to sequence similarities only
id (required)
The ID of the indicated annotation field.

Response: A web page.


Stylesheet Command

Retrieve guidelines for how to render annotations offered by a server.

Scope: Annotation servers.

Command: stylesheet

Format:

PREFIX/das/DSN/stylesheet

Description: This query can be issued to an annotation server in order to retrieve the server's recommendations on formatting annotations retrieved from it. These recommendations are not normative. A viewer is free to use any display format it chooses.

Arguments: None.

Response:

This document is intended to provide hints to the annotation display client. It maps feature categories and types to a series of glyphs known to the display client.

Format:

<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASSTYLE SYSTEM "http://www.biodas.org/dtd/dasstyle.dtd">
<DASSTYLE>
  <STYLESHEET version="X.XX">

     <CATEGORY id="default">
         <TYPE id="default">
	   <GLYPH zoom="high">

             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	   <GLYPH zoom="medium">
             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
	   <GLYPH zoom="low">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
     </CATEGORY>

     <CATEGORY id="group">
         <TYPE id="group_id1">
	   <GLYPH zoom="high">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
           ...
     </CATEGORY>


     <CATEGORY id="category1">
         <TYPE id="default">
	   <GLYPH>
             <ID>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         <TYPE id="type1">

	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>

         </TYPE>
         <TYPE id="type2">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         ...
     </CATEGORY>

     <CATEGORY id="category2">

         <TYPE id="default">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	</TYPE>
         ...
     </CATEGORY>
     ...

</STYLESHEET>
</DASSTYLE>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the stylesheet query, the doctype DTD is "http://www.biodas.org/dtd/dasstyle.dtd".
<DASSTYLE> (required; one only)
The appropriate doctype and root tag is DASSTYLE.
<STYLESHEET> (required; one only)
There is a single <STYLESHEET> tag. Its version (required) attribute indicates the current version of the stylesheet, and can be used for caching purposes.
<CATEGORY> (required; one or more)
There are one or more <CATEGORY> tags, each providing information on the display of a high-level feature category. The id (required) tag uniquely names the category. A special name is "default", which tells the annotation viewer what format to use for categories that are not otherwise specified in the stylesheet. Another special name is "group". A "group" entry indicates the format to use for a particular group of features.
<TYPE> (required; one or more per CATEGORY)
There are one or more <TYPE> tags per <CATEGORY>, each providing display suggestions for one type of annotation. The id (required) uniquely identifies the type. A special id is "default", which, if present, identifies a default style for the enclosing category.
<GLYPH> (required; one or more per TYPE)
There is one or more <GLYPH> tag per <TYPE>. It provides information on what glyph (graphical widget) to use to display the indicated annotation type. The optional zoom attribute, implements a simple form of semantic zooming, and allows the client to select the glyph and its attributes based on the zoom level. Possible values are "high", "medium" and "low". If multiple <GLYPH> tags are present, this attribute must be present in order to select among them. A "high" zoom means that there are fewer base pairs per pixel (high magnification). A "low" zoom shows more base pairs. "Medium" is intermediate. It is left to the client to determine the boundaries for "high", "medium" and "low", since this is a function of the graphics rendering.
<ID> (required; one per GLYPH)
The ID value refers to a recognized glyph from the glyph types list ([#glyphid see below]).
<ATTR> (optional; one or more per ID)
The recognized ATTR (attributes) are determined by which glyph ID is specified. See the [#glyphid glyph types] list below for more information.

Here is a short stylesheet example:


			...
     <CATEGORY id="inferred from similarity (ECO:0000041)">
	<TYPE id="default">
	     <GLYPH>
                  <LINE>
		       <FGCOLOR>gray</FGCOLOR>
                  </LINE>
	     </GLYPH>
	</TYPE>
	<TYPE id="SO:0001066">
	     <GLYPH >
                  <BOX>
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>	
		       <BGCOLOR>red</BGCOLOR>
                  </BOX>
	     </GLYPH>
	</TYPE>
	<TYPE id="SO:0100013">
	     <GLYPH>
                  <TOOMANY>
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>
		       <BGCOLOR>blue</BGCOLOR>
                  </TOOMANY>
	     </GLYPH>
	</TYPE>
	<TYPE id="SO:0001073">
	     <GLYPH>
                  <BOX>
		       <HEIGHT>3</HEIGHT>
		       <FGCOLOR>blue</FGCOLOR>
		       <BGCOLOR>green</BGCOLOR>
                  </BOX>
	     </GLYPH>
	</TYPE>
	<TYPE id="SO:0001074">
	     <GLYPH>
                  
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>gray</FGCOLOR>
                  
	     </GLYPH>
	</TYPE>
     </CATEGORY>
      ...

Provide an ontology-updated stylesheet: A sample stylesheet used for the WormBase DAS server can be found at [sample_stylesheet.xml http://www.biodas.org/documents/sample_stylesheet.xml].

Glyph Types

This section describes a set of generic "glyphs" that can be used by sequence display programs to display the position of features on a sequence map. The annotation server may use these glyphs to send display suggestions to the viewer via the [#stylesheet stylesheet document].

The current set of glyph ID values are:

  • ARROW
  • ANCHORED_ARROW
  • BOX
  • CROSS
  • EX
  • HIDDEN
  • LINE
  • SPAN
  • TEXT
  • TOOMANY
  • TRIANGLE
  • PRIMERS

Each glyph has a set of attributes associated with it. Attribute values come in the following flavors. Note that these are types' of element, not element names.

INT
An integer
FLOAT
A floating point number (not currently used)
STRING
A text string
COLOR
A color. Colors can be specified using the "#RRGGBB" format commonly used in HTML, or as one of the 16 IBM VGA colors recognized by Netscape and Internet Explorer. Ensembl supports more than that...
BOOL
A boolean value, either "yes" or "no".
FONT
A font. Any of the font identifiers recognized by Web browsers is acceptable, e.g. "helvetica".
FONT_STYLE
One of "bold", "italic", "underline".
LINE_STYLE
One of "hat", "solid", "dashed".

Some attributes are shared by all glyphs. Others are glyph-specific. The following attributes are shared in common:

HEIGHT
type: INT
The height of the glyph, in pixels. For the text font, this is equivalent to the FONTSIZE attribute.
FGCOLOR
type: COLOR
The foreground color of the glyph. This is the line and outline color for graphical glyphs, and the font color for text glyphs.
BGCOLOR
type: COLOR
The background color of the glyph. For hollow glyphs, such as boxes, this is the color of the interior of the box. For solid glyphs, such as text, this is ignored
LABEL
BOOL
Whether the glyph should be labeled with its name, as dictated by the <FEATURE> label attribute in the DASGFF document.
BUMP
BOOL
Whether the glyph should "bump" intersecting glyphs so that they do not overlap.

ARROW

A double-headed arrow with an axis either orthogonal or parallel to the sequence map.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

ANCHORED_ARROW

An arrow that has an arrowhead at one end, and an "anchor" (typically a diamond or line) at the other. The arrow points in the direction indicated by the <ORIENTATION> tag.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

BOX

A rectangular box.

Attributes:

LINEWIDTH
type: INT
Width of the box outline.

CROSS

A cross "+". Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

DOT

A dot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

EX

"X" marks the spot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

HIDDEN

A feature that is invisible, intended to support semantic zooming schemes in which a feature is hidden at particular zooms.

Attributes: none.

LINE

A line. Lines are equivalent to arrows with both the northeast and southwest attributes set to "no".

Attributes:

STYLE
type: LINE_STYLE
The line type. A type of "hat" draws an inverted V (commonly used for introns). A type of "solid" draws a horizontal solid line in the indicated color. A type of "dashed" draws a dashed horizonal line in the indicated color.

SPAN

A spanning region, the recommended representation is a horizontal line with vertical lines at each end.

Attributes:

(no glyph-specific attributes)

TEXT

A bit of text.

Attributes:

FONT
type: FONT
The font.
FONTSIZE
type: INT
The font size.
STRING
type: STRING
The text to render.
STYLE
type: FONT_SYTLE
The style in which to render this glyph. Multiple FONT_STYLE attributes may be present.

PRIMERS

Two inward-pointing arrows connected by a line of a different color. Used for showing primer pairs and a PCR product. The length of the arrows is meaningless.

There are no glyph-specific attributes, but in this context the foreground color is the color of the arrows, and the background color is the color of the line that connects them.

TOOMANY

Too many features than can be shown. Recommended for use in consolidating sequence homology hits. The recommended visual presentation is a set of overlapping boxes.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.

TRIANGLE

A triangle. Commonly used for point mutations and other point-like features. The triangle is always drawn in the center of its range, but its width and height can be controlled by HEIGHT and LINEWIDTH respectively.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.
DIRECTION
One of "N", "E", "S", and "W"

Glyphs and Groups

Glyphs and their attributes are typically applied to individual features. However, they can be applied to entire groups as well (via the <GROUP> type attribute). In this case, the glyph will apply to the connecting regions between the individual features within the group. Glyphs for groups are identified in the stylesheet using the special category named "group".

For example, to indicate that the exons in a "transcript" group should be drawn with a yellow box, that the utrs should be drawn with a blue box, and that the connections between exons should be drawn with a hat-shaped line:

Note that these terms aren't in the BS ontology because it is still protein-specific!

<CATEGORY id="inferred from electronic annotation (ECO:00000067)">

   <TYPE id="SO:0000147"> 
      <GLYPH>
         <BOX>
            <BGCOLOR>yellow</BGCOLOR>
         </BOX>
      </GLYPH>
   </TYPE>

   <TYPE id="SO:0000203"> 
      <GLYPH>
         <BOX>
            <BGCOLOR>blue</BGCOLOR>
         </BOX>
      </GLYPH>
   </TYPE>

</CATEGORY>

<CATEGORY id="group">

   <TYPE id="SO:0000673"> 
      <GLYPH>
         <LINE>
            <FGCOLOR>black</FGCOLOR>
            <LINE_STYLE>hat</LINE_STYLE>
         </LINE>
      </GLYPH>
   </TYPE>
</CATEGORY>

Fetching Sequence Assemblies

We are proposing to deprecate this as not many people use it.

Reference servers, but not annotation servers, must represent and serve genome assemblies.

The components of an assembly are treated as a set of features with a type category attribute of "component" and a reference attribute of "yes". Intermediate components of the assembly will also have a subparts attribute of "yes". Components that are the parents of the reference sequence in the assembly have a category attribute of "supercomponent."

Moving Down in an Assembly

For those components that have subparts, the start and end of the feature give the feature's position in the requested segment's coordinate system, and the id, start and end of the <TARGET> element gives the feature's position in its native coordinates.

For example:


         1      200         400                1000
         +--------+-----------+-------------------+ chr22

         1      200 220     1 20                620
         +--------+---- A   --+-------------------+ B

            1    80         280     400
            ------+-----------+-------- C

            =================== C.1
                          ============= C.2

A request for this assembly will look like the following:

http://www.wormbase.org/db/das/elegans/features?segment=chr22:1,1000;category=component

The reference server will return the following (abbreviated) document:


<SEGMENT id="chr22" start="1" stop="1000">

  <FEATURE id="chr22">
    <START>1</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="no" subparts="yes">chr 22</TYPE>

    <TARGET id="chr22" start="1" stop="1000">chr22</TARGET>
    ...
  </FEATURE>

<FEATURE id="Contig:A">
    <START>1</START>

    <STOP>200</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>
    <TARGET id="A" start="1" stop="200">Contig A</TARGET>
    ...
  </FEATURE>

  <FEATURE id="Contig:B">
    <START>400</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>

    <TARGET id="B" start="20" stop="620">Contig B</TARGET>
    ...
  </FEATURE>


  <FEATURE id="Contig:C">
    <START>200</START>

    <STOP>400</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
    <TARGET id="C" start="80" stop="280">Contig C</TARGET>    ...
  </FEATURE>

</SEGMENT>

Notice that contig C is marked as having subparts. This is an indication to the client that it should emit a features request that includes segment C:80,280 in order to discover its components (C.1 and C.2).

Notice also that chr22 appears as a component of itself with the attribute superparts="no" and subparts="yes". This is a side effect of providing information about the component parent.

Moving Up in an Assembly

It is also desirable for a client to fetch the parent of a segment, so as to accomodate the situation in which the user enters the browser at a contig or sequenced clone, and wants to "zoom out."

This situation is complicated by rough draft issues, in which a single rough draft sequence segment may have multiple parents, and some sections of the segment may not belong in the assembly at all. For example:


                        A   B     C   D
           contig21----------->  <-----------contig100

                        |   |    /   /
                        |   |   /   /
             Acc  A ---------------------
                        a   b  c   d

Here, the segment "Acc A" contains two fragments, one of which is located on contig21 and the other on contig100.

To retrieve this information, the client requests the category supercomponent. For segments that are in the middle of the assembly, one or more assembly parents will be returned in addition to subcomponents. The parent <START>, <STOP> and <ORIENTATION> tags are presented in the coordinate system of the requested segment, as always. The start and stop attributes of the <TARGET> tag, denote the corresponding segment in the coordinate system of the parent. As always, start is less than stop, for both the feature and the target.


<SEGMENT id="Acc A" start="1" stop="1000">
   <FEATURE id="contig21_goldenpath_map">
      <START>a</START>
      <STOP>b</STOP>

      <ORIENTATION>+</ORIENTATION>
      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig21" start="A" stop="B"></TARGET>
   </FEATURE>

   <FEATURE id="contig100_goldenpath_map">
      <START>c</START>
      <STOP>d</STOP>
      <ORIENTATION>-</ORIENTATION>

      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig100" start="D" stop="C"></TARGET>
   </FEATURE>
</SEGMENT>

To continue following the parents upward in the assembly, the client will issue further features requests for the target IDs, in this case "contig21" and "contig100". In the general case, following parents will project the requested segment onto a discontinuous set of regions, potentially on different chromosomes. The client may wish to alert the user and refuse to proceed further when it encounters a segment with multiple parents.


Feature Types and Categories

Annotations returned by the features command are classified by type. Specifically, the type refers to the class of data represented by the annotation. Previous versions of this specification gave guidelines for the content (or semantics) of a feature's type, but as of version 1.6 DAS has formally adopted the use of ontologies for this purpose.

The type of an annotation is selected from one of the following ontologies:

Ontology name Ontology ID
Sequence Types and Features SO
Protein Modifications (PSI-MOD) MOD
BioSapiens Annotations BS

The type is further classified by category. The category is a classification of how the annotation was derived, represented as evidence:

Ontology name Ontology ID
Evidence Codes ECO

All ontologies can be browsed and searched using the Ontology Lookup Service at the European Bioinformatics Institute.

These ontologies are applied to the DAS features response in the following manner:

Type ID

The ID attribute of the <TYPE> element is the ontology term ID. For example:

<TYPE id="SO:0000114" ... > ... </TYPE>

Type label

The content of the <TYPE> element is the ontology term name. For example:

<TYPE id="SO:0000114"  ... >methylated_C</TYPE>

Type category

The category attribute of the <TYPE> element is the evidence term name, followed by the evidence term ID in parentheses. For example:

<TYPE id="SO:0000114"  category="inferred from experiment (ECO:0000006)">methylated_C</TYPE>

The following is DEPRECATED:

This is a list of generic feature categories and specific feature types within them. This list was derived from the features currently exported by ACeDB/GFF and is not comprehensive. Suggestions for modifications, additions and deletions are welcomed.

component

This category indicates that the feature is a child component of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve subfeatures contained within it (including subcomponents).

supercomponent

This category indicates that the feature is the parent of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve features that completely contain the selected range of the reference sequence.

translation

The translation category is used for features that relate to regions of the sequence that are translated into proteins. Features that relate to transcription are separate (see below).

Features:

  • stop - position of the translation stop codon
  • ATG - position of the start codon
  • CDS - position of the coding region
  • 5'UTR - untranslated region
  • 3'UTR - untranslated region
  • misc_translated - miscellaneous

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

transcription

The transcription category is used for features that relate to regions of the sequence that are transcribed into RNA.

Features:

  • exon
  • intron
  • tRNA
  • mRNA
  • ncRNA
  • 5'Cap - transcriptional start site
  • PolyA
  • Splice5 - splice donor
  • Splice3 - splice acceptor
  • misc_transcribed

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

variation

The variation category is used for features that relate to regions of the sequence that are polymorphic.

Features:

  • insertion
  • deletion
  • substitution
  • misc_variation

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the variation.

structural

The structural category is used for features that relate to mapping, sequencing and assembly, as well as for various landmarks that carry no intrinsic biological information.

Features:

  • clone
  • primer_left
  • primer_right
  • oligo
  • assembly_tag
  • misc_structural

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the structural feature.

similarity

The similarity category is used for areas that are similar to other sequences. Similarity features should have a <METHOD> tag that indicates the algorithm used for the sequence comparison, and a <TARGET> tag that indicates the target of the match.

Features:

  • NN -- nucleotide to nucleotide similarity (e.g. blastn)
  • NP -- nucleotide to protein similarity (e.g. blastx)
  • PN -- protein to nucleotide similarity (e.g. tblastn)
  • PP -- protein to protein similarity (e.g. tblastx)
  • misc_homology

repeat

The repeat category is used for areas that contain repetitive DNA. This category is used both for low-complexity regions, such as microsatellites, and for more biologically interesting features, such as transposon insertion sites.

Features:

  • microsatellite
  • inverted
  • tandem
  • transposable_element
  • LINE - long repeat not definitely identified as a transposon
  • misc_repeat

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the repetitive element.

experimental

The experimental category is a catchall used to flag areas where there is interesting experimental data of one sort or another. It is intended for use with high-throughput functional genomics work, such as knockouts or insertional mutagenesis screens.

Features:

  • knockout
  • expression_tag
  • microarrayed
  • RNAi_result
  • transgenic
  • mutant - a mutant phenotype associated with region
  • misc_experimental

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the nature of the experimental data.


Other Issues

The distributed annotation system must have a mechanism for detecting and resolving version skew across reference and annotation servers. Although one such mechanism is currently incorporated into the ACeDB-based prototype, it is largely untested and hence not yet a part of the DAS standard.

Changes

Last modified: 08 Oct 2008