Difference between revisions of "Spec Review"

From BioDAS
Jump to: navigation, search
(→‎The Queries)
(→‎Response:)
Line 315: Line 315:
 
<td>xml-stylesheet</td>
 
<td>xml-stylesheet</td>
 
<td>optional</td>
 
<td>optional</td>
−
<td>an XSL stylesheet that e.g. allows a browser to nicely display the XML response <font color="blue">I'm not sure whether this should actually be part of the spec - could be confused with stylesheet command?</font> </td>
+
<td>an XSL stylesheet that e.g. allows a browser to nicely display the XML response <font color="blue">I'm not sure whether this should actually be part of the spec - could be confused with stylesheet command?</font><font color="red"> We should probably highlight the fact that there is a difference and that this is for display in a web browser not how to display in a client. </td>
 
</tr>
 
</tr>
  

Revision as of 12:22, 14 October 2008

Note: this is NOT the official version of the DAS specification.

Distributed Sequence Annotation System (DAS) Spec Review

Oct 1,2008

This is a working document and a proposal for a reworked DAS specification which hopes to clarify the DAS spec based on how DAS is being used in the community today and to include commands from the 1.53E spec and some of the 2.0 spec. Also the document has been adjusted to reflect changes in the use of DAS away from a solely genome centric protocol to a more open one encompassing other reference/coordinate systems such as protein sequences and structures. The spec also includes references to the DAS Registry which is essential for implementing an SOA architecture. Note: this is a technical document but should be readable and understandable by people without a deep understanding of broader technical issues and other system architectures. Note that we are proposing to change dtd for xsd

System Architecture

The Distributed Annotation System is a network of server and client software installations distributed across the web. The DAS protocol is a standard mechanism through which clients can communicate with servers in order to obtain various types of biological data. The protocol defines:

  • the communication method
  • the query model
  • the data format

By enforcing these constraints, DAS allows a client to integrate data from many diverse sources implementing the protocol at a scaleable development cost.

The DAS network of servers comprises a registry, several reference servers and several annotation servers. Tying these together are the concepts of reference objects and coordinate systems.

Reference Objects

Reference objects are items of data with stable identifiers that are targets for annotation. At the most abstract level a reference object might be an annotatable concept or idea (e.g. a particular gene), but usually describes a biological unit within which annotations can be positioned. For example, "P15056" refers to a protein sequence upon which annotations can be based. Similarly, "chromosome 21" refers to a DNA sequence.

Individual reference objects can in fact have several versions, and it is important to recognise that annotations based upon different versions of the same reference entity are not necessarily equivalent.

Annotations

Annotations are pieces of information that are always attributed to a reference object. Annotations are usually positional, that is they refer to a specific location within a reference object. An exon within a genomic sequence is an example. Annotations can also be non-positional, in which case they can be considered as information attributed to the whole of the reference object. For example, the description of a protein or gene.

Coordinate Systems

A coordinate system is a stable, logical grouping of reference objects. A coordinate system provides a mechanism to uniquely identify reference objects that share identifiers, such as chromosomes. For example, chromosome 21 might identify several reference objects from different species', but only one within the NCBI 36 human assembly. Thus, "human NCBI 36 chromosomes" is a coordinate system containing 25 reference objects.

Coordinate systems are formally described using four properties:

  • The category or type of annotatable entity. For example a chromosome sequence or protein structure
  • The authority responsible for defining the coordinate system. For example NCBI or UniProt
  • The version, for coordinate systems containing entities that are not versioned (e.g. genomic assemblies)
  • The species, for coordinate systems containing only entities from a single organism

Of these, category and authority are required.

Some example coordinate systems:

Category Authority Version Species
Chromosome NCBI 36 Homo sapiens
Scaffold ZFISH 7 Danio rerio
Protein sequence UniProt - -

Reference & Annotation Servers

A reference server is a DAS server that provides core data for the reference objects in a particular coordinate system. For example, the reference server for "UniProt Protein sequence" provides the actual sequence for each UniProt entry. It does this by implementing the DAS sequence command. So that clients can discover the available reference objects in a coordinate system, a reference server must also list them via the entry_points command.

Annotation servers are specialized for returning lists of annotations for the reference objects within a coordinate system. This is done by implementing the DAS features command.

In future versions of the spec (i.e. those not focussed entirely on sequence) this will be generalised. That is, reference objects won't be assumed to be sequences and annotations won't be assumed to be sequence features.

Note: The distinction between reference and annotation servers is conceptual rather than physical. That is, a single server instance can in fact play both roles by offering offer both sequences and annotations of those sequences.

Note: A server may support multiple coordinate systems. Since some coordinate systems are subsets of others (such as chromosomes, contigs and clones), this can mean that annotation servers can potentially serve the same annotations on several coordinate systems.

In my opinion, the registry coordinate systems XML (i.e. http://www.dasregistry.org/das/coordinatesystem) should be used to indicate coordinate systems that are subsets of each other which would avoid this problem - clients could then programmatically choose what to query with and what to avoid.

The DAS Registry

The DAS registry is a special component of DAS, fulfilling the following roles:

  1. Catalogues and describes the capabilities and coordinate systems of DAS services
  2. Allows discovery of available DAS services via both human and programmatic interfaces
  3. Automatically validates registered DAS sources to ensure that they correctly implement the protocol
  4. Periodically tests DAS sources and notifies their administrators if they are unavailable
  5. Provides a mechanism for activating or highlighting individual DAS services in clients

Clients

A DAS client typically integrates data from a number of DAS servers, making use of the different data types. For example, a client might implement the following procedure for a particular sequence location:

  1. Contact DAS registry to find reference and annotation servers for the relevant assembly
  2. Obtain sequence from the reference server
  3. Obtain sequence features from each of the annotation servers
  4. Display the annotations in the context of the sequence

This is best explained by diagram

Client/Server Interactions

The DAS is web-based. Clients query the reference and annotation servers using the HTTP protocol (see RFC2616) by sending a formatted URL request to the server. Servers process the request and return a response in the form of a formatted XML document (see W3C Extensible Markup Language) according to a predefined schema.

The Request

All DAS requests take the form of a hierarchical URL. Each URL has a site-specific prefix, followed by a standardized path and query string. The standardized path begins with the string /das. This is followed by URL components containing the data source name and a command. Should put some guidance or specify the ability for servers to accept encoded URLs For example: How do we get everyone to specify say "chromosome1" in the exact same way not "chr1" etc. By coordinate system and entry_points I guess. Reference server MUST implement entry_points, regardless of number of objects (don't expect it to come back quickly). We can always add a "range" parameter later 


http://das.sanger.ac.uk/das/ccds_mouse/features?segment=1:174405453,174408689
^^^^^^^^^^^^^^^^^^^^^^^ ^^^ ^^^^^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
  site-specific prefix  das  data src  command   arguments

In this case, the site-specific prefix is http://das.sanger.ac.uk. The request begins with the standardized path /das, and the data source, in this case /ccds_mouse. This is followed by the command /features, which requests a list of features, and a query string providing named arguments to the /features command.

Thus, a single DAS server hosts one or more DAS sources, allowing it to provide different types of information, and/or information in several coordinate systems. This example source provides consensus CDS transcripts for mouse chromosomes, but the same server provides a number of other sources, including a similar source for human along with sources containing very different types of data.

More information on the format of the request and the various available commands is given [#commands below].

The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.

SOAP has not been widely adopted for das so should we delete this?Yep! The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.

The Response

The response from the server to the client consists of a standard HTTP header with DAS status information within that header, followed optionally by XML content that contains the answer to the query. The DAS status portion of the header consists of three lines. The first is X-DAS-Version and gives the current protocol version number, currently DAS/1.6. The second line is X-DAS-Status and contains a three digit status code which indicates the outcome of the request. The third is X-DAS-Capabilities, which describes the parts of of the spec the server implements.

Here is an example HTTP header: (provided by Web server) 


HTTP/1.1 200 OK                          
Date: Sun, 12 Mar 2000 16:13:51 GMT          
Server: Apache/1.3.6 (Unix) mod_perl/1.19    
Last-Modified: Fri, 18 Feb 2000 20:57:52 GMT 
Connection: close                            
Content-Type: text/plain                     
X-DAS-Version: DAS/1.5
X-DAS-Status: 200
X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...
data follows...

The defined status codes are listed in Table 1.

Table 1: DAS response codes
200 OK, data follows
400 Bad command (command not recognized)
401 Bad data source (data source unknown)
402 Bad command arguments (arguments invalid)
403 Bad reference object (reference sequence unknown)
404 Bad stylesheet (requested stylesheet unknown)
405 Coordinate error (sequence coordinate is out of bounds/invalid)
500 Server error, not otherwise specified
501 Unimplemented feature

The HTTP/1.0 protocol allows web clients to request byte-level compression of the response by sending the HTTP header Accept-Encoding header. Web servers that are capable of it can reply with a Content-transfer-encoding header and a compressed body. Implementors of DAS clients and servers may wish to implement this HTTP feature.

X-DAS-Capabilities

The X-Das-Capabilities header provides an extensible list of the capabilities that the server provides. This can be used by clients wishing to make use of optional components of the DAS protocol where they are supported, and by those writing experimental extensions to DAS to flag clients that those extensions are available. Capabilities have the form CapabilityName/Version and are separated by semicolon, space, as in "capabilityA/1.0; capabilityB/1.4; capabilityC/1.0". The following standard capabilities are present in the DAS/1.6 protocol:

Capability Name Description
dsn/1.0 Deprecate these: The server supports the deprecated dsn request.
dna/1.0 The server supports the deprecated dna request.
types/1.0 The server supports the basic types request.
stylesheet/1.1 The server supports the basic stylesheet request.
features/1.0 The server supports the basic features request.
entry_points/1.0 The server supports the basic entry_points request.
error-segment/1.0 Server will report requests for invalid segments with an <ErrorSegment> response.
unknown-segment/1.0 Server will report requests for unknown or unannotated segments with an <UnknownSegment> response.
unknown-feature/1.0 Server will report requests for unknown features with an <UnknownFeature> response.
feature-by-id/1.0 The features request will accept the CGI parameter "feature_id", enabling the server to look up annotations based on their ID.
group-by-id/1.0 The features request will accept the CGI parameter "group_id", enabling the server to look up annotations based on the ID of a group.
component/1.0 Deprecate? The features request will return components of the indicated segment when a category type of "component" is requested.
supercomponent/1.0 Deprecate? The features request will return supercomponents of the indicated segment when a category type of "supercomponent" is requested.
sequence/1.0 The server supports the sequence request.

Reference Object IDs

The ID used by a client or server to refer to a reference object can contain any set of printable characters (including the space character), but not the colon character (":"), which is reserved for separating reference IDs from sequence ranges (see below). The newline, tab and carriage return characters are also reserved for future use.

A data source that uses the colon character for its internal IDs must map this character to another one on the way in and on the way out. For example: 


   Client request       server's internal id         Response to client

   gi-123456       -->  gi:123456                    --->  gi-123456

   gi-123456:1,1000 --> gi:123456 start=1 stop=1000  --->  gi-123456:1,1000


In general, DAS mandates that a server must respond in the same coordinate system by which it is queried. This is relevant where annotations can potentially exist in several coordinate systems (such as clones and contigs).


The Queries

This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as PREFIX.

Sources Command

Retrieve the list of data sources for a server.

DSN command has been deprecated in favour of this sources cmd

Scope: Reference and annotation servers.

Command: sources

Format: 

PREFIX/das/sources

Description: This query returns the list of data sources that are available from this server. In particular the following information for a DAS server is important:

  • The email address of the maintainer of a DAS source
  • The coordinate system of the provided data
  • Different properties that allow further description of a source

Arguments: none

Response:

The response to the sources command is the "DASSSOURCE" XML-formatted document: 

<?xml version='1.0' encoding='UTF-8' ?>
<?xml-stylesheet type="text/xsl" href="das.xsl"?>
<SOURCES>
 <SOURCE uri="URI" title="title" doc_href="URL" description="description">
    <MAINTAINER email="email address" />
    <VERSION uri="URI" created="date">
      <COORDINATES uri="uri" source="data type" authority="authority" test_range="ID">coordinate string</COORDINATES>      
      <CAPABILITY type="das1:command" query_uri="URL" />
      <PROP name="key" value="value" />     
     </VERSION>
   </SOURCE>
</SOURCES>

Format:

xml-stylesheet optional an XSL stylesheet that e.g. allows a browser to nicely display the XML response I'm not sure whether this should actually be part of the spec - could be confused with stylesheet command? We should probably highlight the fact that there is a difference and that this is for display in a web browser not how to display in a client. </td>

</tr>

SOURCES</td> mandatory</td> the main container for several DAS sources</td>

</tr>

SOURCE</td> mandatory, one or many</td> the description for a DAS datasource</td>

</tr>

uri</td> mandatory</td> a unique URI for the DAS source</td>

</tr>

title, description</td> mandatory</td> the nickname under which a DAS server shall be known and displayed in a view.

The description is a free text description of the provided data</td>

</tr>

doc_href</td> optional</td> points to a web site where more information about a DAS source can get obtained.</td>

</tr>

MAINTAINER, email</td> mandatory</td> the email address of the maintainer of this DAS source.</td>

</tr>

VERSION</td> mandatory</td> in principle this would allow hosting several versions of a DAS sources (with unique URIs)

on a server, but in practise most people provide only the server with the latest data. Different versions of the same source should be considered to beequivalent, that is the latest version is definitive. The created attribute provides the date on which a DAS server has been set up initially. For a DAS registation server this is the date at which a DAS server has been pulished. 

</td>

</tr>


COORDINATES</td> mandatory, one or many</td> The description of the coordinate system(s) a DAS source operates on.

uri - the unique URI for a DAS coordinate system. For a DAS registration server these should be resolvable and allow to access more information. e.g. [1] for the UniProt,Protein Sequence coordinate system.

source - the data type. This refers to the "physical dimension" of the data. Currently the following categories are available: Chromosome, Clone, Contig, Gene_ID, NT_Contig, Protein Sequence, Protein Structure

authority - the authority, or institution that assigns the accession code for this namespace. In case of genome assemblies the authority that builds the assembly.


version - (optional) for genome assemblies the version of the build.
To learn more about coordinate systems, please see <a href="help_coords.jsp">here</a>.

</td> </tr>

CAPABILTIY</td> mandatory, one or many</td> The supported DAS commmand

type - the type of the DAS command. to distinguish DAS/1 from DAS/2 servers das1: is used before the name of the command.
query_urithe URL of the server location, with the command attached. e.g. http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/features

Note: For some DAS commands this will not resolve, since e.g. for the features command the extension 
/features?segment=ID
needs to be attached.

</td> </tr>

PROP</td> optional, one or many</td> a free key- value style property that allows to add more tags to a server</td>

</tr>

</table> </div>

Example Responses



Entry Points Command

Retrieve the list of reference objects for a data source

This Entry_Points cmd is now mandatory for reference servers. Scope: Reference servers.

Command: entry_points

Format: 

PREFIX/das/DSN/entry_points

Description: This query returns the list of sequence entry points available and their sizes in base pairs.

Arguments:

ref (deprecated)
If a sequence reference ID is provided in the ref argument, the query will return the components of the sequence (its subsequences) rather than the list of top-level entry point sequences. This argument is DEPRECATED, and superseded by the "component" category of the features request.
type (deprecated)
For ACEDB servers, the type parameter provides the class of the reference sequence, Sequence by default. DEPRECATED

Response:

The response to the entry_points command is the "DASEP" XML-formatted document:

Format: 

<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd">
<DASEP>
  <ENTRY_POINTS href="url" version="X.XX">
    <SEGMENT id="id1" start="start1" stop="stop1" type="type" is now deprecated due to the registry should specify the type in this coordinate system  orientation="+">descriptive text</SEGMENT>

    <SEGMENT id="id2" start="start2" stop="stop2" type="type" orientation="+">descriptive text</SEGMENT>
    <SEGMENT id="id3" start="start3" stop="stop3" type="type" orientation="+">descriptive text</SEGMENT>

    ...
  </ENTRY_POINTS>
</DASEP>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the entry_points query, the doctype DTD is "http://www.biodas.org/dtd/dasep.dtd".
<DASEP> (required, one only)
The appropriate doctype and root tag is DASEP.
<ENTRY_POINTS> (The start and stop are now optional, only one)
There is a single <ENTRY_POINTS> tag. It has a version number (required) in the form "N.NN". Whenever the DNA of the entry point changes, the version number should change as well. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (optional; zero or more)
Each segment contains the attributes id, start, stop and orientation. The id is a unique identifier, which can be used as the reference ID in further requests to DAS. The start and stop indicate the start and stop positions of the segment. Orientation is one of "+" or "-" and indicates the strandedness of the segment (use "+" if the segment is not intrinsically ordered)The orientation is now optional.. If the optional subparts attribute is present and has the value "yes", it indicates that the segment has subparts.The subparts section is now deprecated? The type section is now deprecated as this should be specified by the registry.For compatibility with older versions of the specification, the <SEGMENT> tag can use a size attribute rather than start and stop, and can omit the orientation attribute: 
      <SEGMENT id="id" size="123456">
       In this case, the start is implied to be "1" and the stop is implied to be the same as the length.

Note: The result from the entry points requests does not carry sufficient information to reconstruct a complex sequence assembly. Instead, use the features request with a category of "component". See [#assemblies Fetching Sequence Assemblies].

Retrieve the DNA Associated with a Subsequence has been deprecated as the sequence cmd below is more commonly used.

Sequence Command

Retrieve all or part of the sequence for a reference object.

Scope: Reference servers.

Command: sequence

Format: 

PREFIX/das/DSN/sequence?segment=RANGE[;segment=RANGE...]

Description: This query returns the sequence (nucleotide or protein) corresponding to the indicated segment.

Arguments:

segment (required; one or more)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. If the start and stop positions are not provided, then the entire reference sequence is returned.

Here is an example of a valid request that uses the segment argument to fetch three independent segments. The last segment is a subsequence: 

    http://www.ebi.ac.uk/das-srv/uniprot/das/uniprot/sequence?
        segment=P00280;segment=P15056;segment=P51587:200,300

Response:

The response to sequence is the "DASSEQUENCE" XML-formatted document.

Format: 

<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASSEQUENCE SYSTEM "http://www.biodas.org/dtd/dassequence.dtd">
<DASSEQUENCE>

  <SEQUENCE id="id" start="start" stop="stop"
               
      atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat
      taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc
      agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa
      taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa
      aaatgagaaaaatcgacgaaaatcggtataaaatcaaataaaaatagaaggaaaatattc
      agctcgtaaacccacacgtgcggcacggtttcgtgggcggggcgtctctgccgggaaaat
      tttgcgtttaaaaactcacatataggcatccaatggattttcggattttaaaaattaata
      taaaatcagggaaatttttttaaattttttcacatcgatattcggtatcaggggcaaaat
      tagagtcagaaacatatatttccccacaaactctactccccctttaaacaaagcaaagag
      cgatactcattgcctgtagcctctatattatgccttatgggaatgcatttgattgtttcc
      gcatattgtttacaaccatttatacaacatgtgacgtagacgcactgggcggttgtaaaa
      cctgacagaaagaattggtcccgtcatctactttctgattttttggaaaatatgtacaat
      gtcgtccagtattctattccttctcggcgatttggccaagttattcaaacacgtataaat
      aaaaatcaataaagctaggaaaatattttcagccatcacaaagtttcgtcagccttgtta
      tgtcaaccactttttatacaaattatataaccagaaatactattaaataagtatttgtat
      gaaacaatgaacactattataacattttcagaaaatgtagtatttaagcgaaggtagtgc
      acatcaaggccgtcaaacggaaaaatttttgcaagaatca
  </SEQUENCE>
</DASDNA>
<!DOCTYPE> (required; one only)
xsd instead of dtd.
<DASSEQUENCE> (required; one only)
The appropriate doctype and root tag is DASSEQUENCE.
<SEQUENCE> (required; one or more)
There is a single <SEQUENCES> tag per requested segment. It has the attributes id, which indicates the reference ID for this sequence, start and stop, which indicate the position of this segment within the reference sequence, Deprecate this as not consistent with registry and coordinate system? Yep moltype, which indicates the molecular type of the sequence, and version, which provides the version of the reference sequence. The molecule type is one of DNA, ssRNA, dsRNA, or Protein. No provision is made for circular molecules. The version may be either a numerical value or a digest such as MD5 checksum. All five attributes are required. The content of this tag is the sequence itself, using standard IUPAC codes for DNA, RNA and protein.

Types Command

Retrieve the types of features offered by a data source

how do we reconcile the way UCSC and ensembl uses the type command i.e. UCSC use it as a filter for tracks from one source, whereas ensembl only has one track per source!!! Can't deprecate this command as is used by UCSC??? Make the unit of registration in the registry the combination of the source and type(s), and we will make Ensembl will honour it and apply the filter.

Scope: Annotation and reference servers.

Command: types

Format: 


PREFIX/das/DSN/types [?segment=RANGE]
                                   [;segment=RANGE]
                                   [;type=TYPE]
                                   [;type=TYPE]

Description: This query returns the annotation available for a segment of sequence.

Arguments:

segment (optional)
This is the sequence range. It uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive.
type (optional)
One or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be used.

If one or more segment arguments are provided, the list of types returned is restricted to the indicated segments. If no segment argument is provided, then all feature types known to the source are returned.

Response:

The document returned from the types request is an XML-formatted "DASTYPES" documents. This is a shortened form of the full features format (see below) and is used to summarize the type and number of each annotation. Annotation types can be grouped into segments, or be totaled across the entire database. 


<?xml version="1.0" standalone="no"?>
<!DOCTYPE DASTYPES SYSTEM "http://www.biodas.org/dtd/dastypes.dtd">

<DASTYPES>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

     <TYPE id="id1" method="method" category="category">Type Count 1</TYPE>
     <TYPE id="id2" method="method" category="category">Type Count 2</TYPE>

     ...
  </SEGMENT>
  </GFF>
</DASTYPES>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the types query, the doctype DTD is "http://www.biodas.org/dtd/dastypes.dtd".
<DASTYPES> (required; one only)
The appropriate doctype and root tag is DASTYPES.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0. The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment. The id, start and stop attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The version attribute (required) indicates the current version of the sequence map. The optional label attribute supplies a human readable label for display purposes. DEPRECATE: The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
<TYPE> (optional; zero or more per SEGMENT)
Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are id (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), method (optional), which indicates the method (subtype) for the feature type and the category (optional) attribute, which provides functional grouping to related types. The tag contents (optional) is a count of the number of features of this type across the segment.

Features Command

Retrieve the annotations for all or part of a reference object

Scope: Reference and annotation servers.

Command: features

Format: 


PREFIX/das/DSN/features?segment=REF:start,stop[;segment=REF:start,stop...]
                                      [;type=TYPE]
                                      [;type=TYPE]
                                      [;category=CATEGORY]
                                      [;category=CATEGORY]
                                      [;categorize=yes|no]
                                      [;feature_id=ID]
                                      [;group_id=ID]

Description: This query returns the annotations across one or more segments of sequence.

Arguments:

segment (zero or more)
If specified, the segment argument restricts the list of annotations to those that overlap the indicated range. Each segment argument uses the format format reference:start,stop, where reference is the ID of the reference sequence used to establish the coordinate system, and start and stop are the endpoints of the region to query, inclusive. Multiple segments may be specified.
type (zero or more)
Zero or more type IDs to be used for filtering annotations on the type field. If multiple type names are provided, the resulting list of features will be the logical OR of the list. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on.
category (zero or more)
Zero or more category IDs to be used for filtering annotations by category. If multiple categories are provided, they are treated as the logical OR. For compatibility with versions 0.997 and earlier of this protocol, servers are allowed to treat the type ID as a regular expression, but this feature is deprecated and should not be relied on. (we also encourage the use of ECO numbers to represent the method of annotation e.g.ECO:0000032 "inferred from curated blast match to nucleic acid).
categorize (optional)
what to do with this? Either "yes" or "no" (default). If "yes", then each annotation must include its functional category.
feature_id (zero or more; new in 1.5)
Instead of, or in addition to, segment arguments, you may provide one or more feature_id arguments, whose values are the identifiers of particular features. If the server supports this operation, it will translate the feature ID into the segment(s) that strictly enclose them and return the result in the features response. It is possible for the server to return multiple segments if the requested feature is present in multiple locations.
group_id (zero or more; new in 1.5)
The group_id argument, is similar to feature_id, but retrieves segments that contain the indicated feature group.

Annotations must be returned using the coordinate system in which they were requested. For example, if a contig ID was used to specify the segment, then the annotation endpoints must use contig coordinates. Servers should return annotations which overlap the segment, but are not completely contained within them. Annotation servers are no longer allowed to only return annotations which are completely contained within the indicated segment. This is confusing. Better as: Servers should return annotations which lie wholly or partially within the query segment. For example: 

       -------------------
              Query       

-----   ---   -------    -----------   -----
  A      B       C            D          E

In the above example, the server should return annotations B and C because they lie wholly within the query segment, and annotation D because it lies partially within the query segment.

If multiple segment arguments are provided and they happen to overlap, then the annotation server may return the same annotation multiple times, possibly using different coordinate systems. It is the responsibility of the client to merge annotations based on the assembly.

Response:

The document returned from the features request is an XML-formatted "DASGFF" document.

Format: 


<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASGFF SYSTEM "http://www.biodas.org/dtd/dasgff.dtd">
<DASGFF>
  <GFF version="1.0" href="url">
  <SEGMENT id="id" start="start" stop="stop" type="type" version="X.XX" label="label">

      <FEATURE id="id" label="label">
         <TYPE id="id" category="category" reference="yes|no">type label</TYPE>

         <METHOD id="id"> method label </METHOD>
         <START> start </START>
         <END> end </END>

         <SCORE> [X.XX|-] </SCORE>
         <ORIENTATION> [0|-|+] </ORIENTATION>
         <PHASE> [0|1|2|-]</PHASE>

         <NOTE> note text </NOTE>
	 <LINK href="url"> link text </LINK>
	 <TARGET id="id" start="x" stop="y">target name</TARGET>

	 <GROUP id="id" label="label" type="type">
	       <NOTE> note text </NOTE>
	       <LINK href="url"> link text </LINK>

	       <TARGET id="id" start="x" stop="y">target name</TARGET>
         </GROUP>
      </FEATURE>
      ...
  </SEGMENT>
  </GFF>

</DASGFF>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the features query, the doctype DTD is "http://www.biodas.org/dtd/dasgff.dtd".
<DASGFF> (required; one only)
The appropriate doctype and root tag is DASGFF.
<GFF> (required; one only)
There is a single <GFF> tag. Its version (required) attribute indicates the current version of the XML form of the General Feature Format. The current version is (arbitrarily) 1.0 The href (required) attribute echoes the URL query that was used to fetch the current document.
<SEGMENT> (required; one or more)
The <SEGMENT> tag provides information on the reference segment coordinate system. The id, start and stop attributes indicate the position of the segment. The version attribute indicates the current version of the sequence map. The id, start, stop, and version attributes are required. The optional label attribute provides a human readable label for display purposes. The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.
<FEATURE> (optional; zero or more per SEGMENT)
There are zero or more <FEATURE> tags per <SEGMENT>, each providing information on one annotation. The id attribute (required) is a unique identifier for the feature. It can be used as a reference point for further navigation. The label attribute (optional) is a suggested label to display for the feature. If not present, the id attribute can be used instead.
<TYPE> (required; one per FEATURE)
Each feature has just one <TYPE> field, which indicates the type of the annotation. The attributes are id (required), which is a unique id for the annotation type and can be used to retrieve further information from the annotation server (see [#feature_linking Linking to a Feature]), and the category (optional, recommended) attribute, which provides functional grouping to related types. The reference server's annotations can consist of additional overlapping landmarks (parents, children, and neighbors), which should be marked "yes" in the third attribute reference (optional, defaults to "no") to indicate that the feature is a structural landmark within the map (this feature can be annotated). The tag contents (optional) is a human readable label for display purposes.If a reference annotation has either or both of the optional attributes, subparts="yes" and superparts="yes", then in addition to being useable as a reference sequence, the feature contains subparts and/or superparts that themselves can act as reference features. This can be used to reconstruct reference server's assembly. See also [#fetching_assembly Fetching Assembly Information].
<METHOD> (required; one per FEATURE)
Each feature has one <METHOD> field, which identifies the method used to identify the feature. The id (optional) tag can be used to retrieve further information from the annotation server. The tag contents (optional) is a human readable label.
<START>, <END> ( optional; one apiece per FEATURE)
These tags indicate the start and end of the feature in the coordinate system of the reference sequence given in the <SEGMENT> tag. The relationship between the feature start and stop positions and the segment start and stop is that the two spans are guaranteed to overlap.
<SCORE> ( optional; one per FEATURE)
This is a floating point number indicating the "score" of the method used to find the current feature. The number can only be understood in the context of information retrieved from the server by linking to the method. If this field is inapplicable, the contents of the tag can be replaced with a - symbol.
<ORIENTATION> ( optional; one per FEATURE)
This tag indicates the orientation of the feature relative to the direction of transcription. It may be for features that are unrelated to transcription, +, for features that are on the sense strand, and -, for features on the antisense strand.
<PHASE> ( optional; one per FEATURE)
This tag indicates the position of the feature relative to open reading frame, if any. It may be one of the integers , 1 or 2, corresponding to each of the three reading frames, or - if the feature is unrelated to a reading frame.
<NOTE> (optional; zero or more per FEATURE)
A human-readable note in plain text format.
<LINK> (optional; zero or more per FEATURE)
A link to a web page somewhere that provides more information about this feature. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per FEATURE)
The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. More information on the target can be retrieved by linking back to the annotation server. See [#feature_linking Linking to a Feature].
<GROUP> (optional; zero or more per FEATURE)
The <GROUP> section is slightly odd, as it is derived from an overloaded field in the GFF flat file format. It provides a unique "group" ID that indicates when certain features are related to each other. The canonical example is the CDS, exons and introns of a transcribed gene, which logically belong together. The group id attribute (required) provides an identifier that should be used by the client to group features together visually. Unlike other IDs in this protocol, the group ID cannot be used as a database handle to retrieve further information about the group. Such information can, however, be provided within <GROUP> section, which may contain up to three optional tags.The label attribute (optional) provides a human-readable string that can be used in graphical representations to label the glyph.The type attribute (optional) provides a type ID for the group as a whole, for example "transcript". This ID can be used as a key into the [#stylesheet stylesheet] to select the glyph and graphical characteristics for the group as a whole.
<NOTE> (optional; zero or more per GROUP)
A human-readable note in plain text format.
<LINK> (optional; zero or more per GROUP)
A link to a web page somewhere that provides more information about this group. The href (required) attribute provides the URL target for the link. The link text is an optional human readable label for display purposes.
<TARGET> (optional; zero or more per GROUP)
The target sequence in a sequence similarity match. The id attribute provides the reference ID for the target sequence, and the start and stop attributes indicate the segment that matched across the target sequence. All three attributes are required. NOTE: although this tag is present in the GROUP section, it applies to the FEATURE, and it is preferred to place it directly in the <FEATURE> section. Earlier versions of this specification placed the TARGET tag in the GROUP section, and clients must recognize and accomodate this.

Annotations have an ID that is unique to the server and a structured description that describes its nature and attributes. Annotations may also be associated with Web URLs that provide additional human readable information about the annotation.


Annotations have types, methods and categories. The annotation type is selected from a list of types that have biological significance and previously correspond roughly to EMBL/GenBank feature table tags. Examples of annotation types include "exon", "intron", "CDS" and "splice3."(We encourage the use of the http://www.sequenceontology.org/ Sequence Ontology IDs to give uniformity to DAS sources for example CDS is SO:0000316). The annotation method (what are we doing with annotion method if catagory is handling this??method is intended to describe how the annotated feature was discovered, and may include a reference to a software program .

To look up ontologies you could go here: "http://www.ebi.ac.uk/ontology-lookup/"

category is a broad functional category that can be used to filter, group and sort annotations. "Homology", "variation" and "transcribed" are all valid categories. The existence of these categories allows researchers to add new annotation types if the existing list is inadequate without entirely losing all semantic value. (we also encourage the use of ECO numbers to represent the method of annotation e.g.ECO:0000032 "inferred from curated blast match to nucleic acid).

Example

<TYPE id="SO:0000417" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_domain</TYPE>



It is intended that larger annotation servers provide pointers to human-readable data that describes its types, methods and categories in more detail.

New in version 1.5: Exception Handling for Invalid Segments

The request for a named segment may fail because: (1) the reference sequence is not known to the server or (2) the requested region is outside the bounds of the segment. In both cases, an exception is indicated. In the case of a reference server, which is expected to be authoritative for the map, the <GFF> section will flag the problem by issuing an <ERRORSEGMENT> tag instead of the usual <SEGMENT> tag. This tag has the following format: <ERRORSEGMENT id="id" start="start" stop="stop">The id attribute (required) corresponds to the ID of the requested segment, and start and stop (optional) correspond to the requested bounds of the segment if this was specified in the request.Unlike a reference server, an annotation server is not required to know the identities of all the segments. Therefore when presented with a segment ID that it doesn't recognize, it can't know whether this is a true client error or merely an unannotated segment. In this case, an annotation server will issue an <UNKNOWNSEGMENT> tag. This tag has the same syntax as <ERRORSEGMENT> but doesn't necessarily imply an error.If an annotation server detects a request for a region outside the bounds of a segment that it has annotated, it will issue an <ERRORSEGMENT> exception.In the case of a request for multiple segments, the server will return a mixture of <SEGMENT> sections for valid segments, and <ERRORSEGMENT> or <UNKNOWNSEGMENT> sections for invalid ones.

Examples

<DASGFF><GFF version="1.01" href="http://das.sanger.ac.uk:80/das/pfam/features"><SEGMENT id="P08487" version="d1dfb367c112d4820eeffe4eab1d6487" start="1" stop="1291"><FEATURE id="C2" label="C2:1090-1177"><TYPE id="SO:0000417" category="inferred from reviewed computational analysis (ECO:0000053)">polypeptide_domain</TYPE><START>1090</START><END>1177</END><METHOD id="Pfam">Pfam-A</METHOD><SCORE>1.7e-18</SCORE><NOTE>HMMER Version: 2.3.2</NOTE><LINK href="http://pfam.sanger.ac.uk/family?entry=PF00168">C2</LINK></FEATURE></SEGMENT></GFF></DASGFF>

We are proposing to remove Linking to a Feature from the spec, as implementations tend to use a separate web server anyway

Scope: Annotation servers.

Command: link

Format: 


PREFIX/das/DSN/link?field=TAG;id=ID

Description: This query can be issued in order to retrieve further human-readable information about an annotation. It is best to pass this URL directly to a browser, as the type of the returned data is not specified (it will typically be an HTML file, but any MIME format is allowed).

Arguments:

field (required)
The field to fetch further information on. Options are:
  • feature -- the feature itself
  • type -- the feature type
  • method -- the feature method
  • category -- the feature category
  • target -- the target, applicable to sequence similarities only
id (required)
The ID of the indicated annotation field.

Response: A web page.

Retrieving the Stylesheet

Scope: Annotation servers.

Command: stylesheet

Format: 


PREFIX/das/DSN/stylesheet

Description: This query can be issued to an annotation server in order to retrieve the server's recommendations on formatting annotations retrieved from it. These recommendations are not normative. A viewer is free to use any display format it chooses.

Arguments: None.

Response:

This document is intended to provide hints to the annotation display client. It maps feature categories and individual types to a series of glyphs known to the display client.

Format: 


<?xml version="1.0" standalone="no"?>

<!DOCTYPE DASSTYLE SYSTEM "http://www.biodas.org/dtd/dasstyle.dtd">
<DASSTYLE>
  <STYLESHEET version="X.XX">

     <CATEGORY id="default">
         <TYPE id="default">
	   <GLYPH zoom="high">

             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	   <GLYPH zoom="medium">
             <ID>
	       <ATTR>value</ATTR>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
	   <GLYPH zoom="low">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
     </CATEGORY>

     <CATEGORY id="group">
         <TYPE id="group_id1">
	   <GLYPH zoom="high">
             <ID>
	       <ATTR>value</ATTR>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
           ...
     </CATEGORY>


     <CATEGORY id="category1">
         <TYPE id="default">
	   <GLYPH>
             <ID>

	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         <TYPE id="type1">

	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>
	   </GLYPH>

         </TYPE>
         <TYPE id="type2">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>

	       ...
             </ID>
	   </GLYPH>
         </TYPE>
         ...
     </CATEGORY>

     <CATEGORY id="category2">

         <TYPE id="default">
	   <GLYPH>
             <ID>
	       <ATTR>value</ATTR>
	       ...
             </ID>

	   </GLYPH>
	</TYPE>
         ...
     </CATEGORY>
     ...

</STYLESHEET>
</DASSTYLE>

<!DOCTYPE> (required; one only)
The doctype indicates which formal DTD specification to use. For the stylesheet query, the doctype DTD is "http://www.biodas.org/dtd/dasstyle.dtd".
<DASSTYLE> (required; one only)
The appropriate doctype and root tag is DASSTYLE.
<STYLESHEET> (required; one only)
There is a single <STYLESHEET> tag. Its version (required) attribute indicates the current version of the stylesheet, and can be used for caching purposes.
<CATEGORY> (required; one or more)
There are one or more <CATEGORY> tags, each providing information on the display of a high-level feature category. The id (required) tag uniquely names the category. A special name is "default", which tells the annotation viewer what format to use for categories that are not otherwise specified in the stylesheet. Another special name is "group". A "group" entry indicates the format to use for a particular group of features.
<TYPE> (required; one or more per CATEGORY)
There are one or more <TYPE> tags per <CATEGORY>, each providing display suggestions for one type of annotation. The id (required) uniquely identifies the type. A special id is "default", which, if present, identifies a default style for the enclosing category.
<GLYPH> (required; one or more per TYPE)
There is one or more <GLYPH> tag per <TYPE>. It provides information on what glyph (graphical widget) to use to display the indicated annotation type. The optional zoom attribute, implements a simple form of semantic zooming, and allows the client to select the glyph and its attributes based on the zoom level. Possible values are "high", "medium" and "low". If multiple <GLYPH> tags are present, this attribute must be present in order to select among them. A "high" zoom means that there are fewer base pairs per pixel (high magnification). A "low" zoom shows more base pairs. "Medium" is intermediate. It is left to the client to determine the boundaries for "high", "medium" and "low", since this is a function of the graphics rendering.
<ID> (required; one per GLYPH)
The ID value refers to a recognized glyph from the glyph types list ([#glyphid see below]).
<ATTR> (optional; one or more per ID)
The recognized ATTR (attributes) are determined by which glyph ID is specified. See the [#glyphid glyph types] list below for more information.

Here is a short stylesheet example: 


			...
     <CATEGORY id="Similarity">
	<TYPE id="default">
	     <GLYPH>

                  <LINE>
		       <FGCOLOR>gray</FGCOLOR>
                  </LINE>
	     </GLYPH>
	</TYPE>

	<TYPE id="NN">
	     <GLYPH >
                  <BOX>
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>	
		       <BGCOLOR>red</BGCOLOR>

                  </BOX>
	     </GLYPH>
	</TYPE>
	<TYPE id="NP">
	     <GLYPH>
                  <TOOMANY>

		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>black</FGCOLOR>
		       <BGCOLOR>blue</BGCOLOR>
                  </TOOMANY>

	     </GLYPH>
	</TYPE>
	<TYPE id="PN">
	     <GLYPH>
                  <BOX>
		       <HEIGHT>3</HEIGHT>

		       <FGCOLOR>blue</FGCOLOR>
		       <BGCOLOR>green</BGCOLOR>
                  </BOX>
	     </GLYPH>
	</TYPE>

	<TYPE id="PP">
	     <GLYPH>
                  
		       <HEIGHT>4</HEIGHT>
		       <FGCOLOR>gray</FGCOLOR>

                  
	     </GLYPH>
	</TYPE>
     </CATEGORY>
      ...

Groups can also have stylesheet entries. If present, they are located in the category named "group". Typically a group will be associated with the "line" glyph, which as described below, draws connections between the members of a group.

A sample stylesheet used for the WormBase DAS server can be found at [sample_stylesheet.xml http://www.biodas.org/documents/sample_stylesheet.xml].

Glyphs and Groups

Glyphs and their attributes are typically applied to individual features. However, they can be applied to entire groups as well (via the <GROUP> type attribute). In this case, the glyph will apply to the connecting regions between the components of the group.

For example, to indicate that the exons in a "transcript" group should be drawn with a yellow box, that the utrs should be drawn with a blue box, and that the connections between exons should be drawn with a hat-shaped line: 


<CATEGORY id="Transcription">
   <TYPE id="exon">
      <GLYPH>
         <BOX>
            <BGCOLOR>yellow</BGCOLOR>

         </BOX>
      </GLYPH>
   </TYPE>

   <TYPE id="utr">
      <GLYPH>
         <BOX>

            <BGCOLOR>blue</BGCOLOR>
         </BOX>
      </GLYPH>
   </TYPE>
</CATEGORY>

<CATEGORY id="group">
<TYPE id="transcript">
   <GLYPH>
      <LINE>
         <FGCOLOR>black</FGCOLOR>
         <LINE_STYLE>hat</LINE_STYLE>

      </LINE>
   </GLYPH>
</TYPE>
...

Fetching Sequence Assemblies We are proposing to deprecate this as not many people use it????

Reference servers, but not annotation servers, must represent and serve genome assemblies.

The components of an assembly are treated as a set of features with a type category attribute of "component" and a reference attribute of "yes". Intermediate components of the assembly will also have a subparts attribute of "yes". Components that are the parents of the reference sequence in the assembly have a category attribute of "supercomponent."

Moving Down in an Assembly

For those components that have subparts, the start and end of the feature give the feature's position in the requested segment's coordinate system, and the id, start and end of the <TARGET> element gives the feature's position in its native coordinates.

For example: 


         1      200         400                1000
         +--------+-----------+-------------------+ chr22

         1      200 220     1 20                620
         +--------+---- A   --+-------------------+ B

            1    80         280     400
            ------+-----------+-------- C

            =================== C.1
                          ============= C.2

A request for this assembly will look like the following: 


http://www.wormbase.org/db/das/elegans/features?segment=chr22:1,1000;category=component

The reference server will return the following (abbreviated) document: 


<SEGMENT id="chr22" start="1" stop="1000">

  <FEATURE id="chr22">
    <START>1</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="no" subparts="yes">chr 22</TYPE>

    <TARGET id="chr22" start="1" stop="1000">chr22</TARGET>
    ...
  </FEATURE>

<FEATURE id="Contig:A">
    <START>1</START>

    <STOP>200</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>
    <TARGET id="A" start="1" stop="200">Contig A</TARGET>
    ...
  </FEATURE>

  <FEATURE id="Contig:B">
    <START>400</START>
    <STOP>1000</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="no">a contig</TYPE>

    <TARGET id="B" start="20" stop="620">Contig B</TARGET>
    ...
  </FEATURE>


  <FEATURE id="Contig:C">
    <START>200</START>

    <STOP>400</STOP>
    <TYPE id="Contig" category="component" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
    <TARGET id="C" start="80" stop="280">Contig C</TARGET>    ...
  </FEATURE>

</SEGMENT>

Notice that contig C is marked as having subparts. This is an indication to the client that it should emit a features request that includes segment C:80,280 in order to discover its components (C.1 and C.2).

Notice also that chr22 appears as a component of itself with the attribute superparts="no" and subparts="yes". This is a side effect of providing information about the component parent.

Moving Up in an Assembly

It is also desirable for a client to fetch the parent of a segment, so as to accomodate the situation in which the user enters the browser at a contig or sequenced clone, and wants to "zoom out."

This situation is complicated by rough draft issues, in which a single rough draft sequence segment may have multiple parents, and some sections of the segment may not belong in the assembly at all. For example: 


                        A   B     C   D
           contig21----------->  <-----------contig100

                        |   |    /   /
                        |   |   /   /
             Acc  A ---------------------
                        a   b  c   d

Here, the segment "Acc A" contains two fragments, one of which is located on contig21 and the other on contig100.

To retrieve this information, the client requests the category supercomponent. For segments that are in the middle of the assembly, one or more assembly parents will be returned in addition to subcomponents. The parent <START>, <STOP> and <ORIENTATION> tags are presented in the coordinate system of the requested segment, as always. The start and stop attributes of the <TARGET> tag, denote the corresponding segment in the coordinate system of the parent. As always, start is less than stop, for both the feature and the target. 


<SEGMENT id="Acc A" start="1" stop="1000">
   <FEATURE id="contig21_goldenpath_map">
      <START>a</START>
      <STOP>b</STOP>

      <ORIENTATION>+</ORIENTATION>
      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig21" start="A" stop="B"></TARGET>
   </FEATURE>

   <FEATURE id="contig100_goldenpath_map">
      <START>c</START>
      <STOP>d</STOP>
      <ORIENTATION>-</ORIENTATION>

      <TYPE id="Contig" category="supercomponent" reference="yes" superparts="yes" subparts="yes">a contig</TYPE>
      <TARGET id="contig100" start="D" stop="C"></TARGET>
   </FEATURE>
</SEGMENT>

To continue following the parents upward in the assembly, the client will issue further features requests for the target IDs, in this case "contig21" and "contig100". In the general case, following parents will project the requested segment onto a discontinuous set of regions, potentially on different chromosomes. The client may wish to alert the user and refuse to proceed further when it encounters a segment with multiple parents.

Feature Types and Categories

This is a list of generic feature categories and specific feature types within them. This list was derived from the features currently exported by ACeDB/GFF and is not comprehensive. Suggestions for modifications, additions and deletions are welcomed.

component

This category indicates that the feature is a child component of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve subfeatures contained within it (including subcomponents).

supercomponent

This category indicates that the feature is the parent of the reference sequence in the current assembly. When combined with the reference="yes" attribute, this indicates that the feature can be used as a reference point to retrieve features that completely contain the selected range of the reference sequence.

translation

The translation category is used for features that relate to regions of the sequence that are translated into proteins. Features that relate to transcription are separate (see below).

Features:

  • stop - position of the translation stop codon
  • ATG - position of the start codon
  • CDS - position of the coding region
  • 5'UTR - untranslated region
  • 3'UTR - untranslated region
  • misc_translated - miscellaneous

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

transcription

The transcription category is used for features that relate to regions of the sequence that are transcribed into RNA.

Features:

  • exon
  • intron
  • tRNA
  • mRNA
  • ncRNA
  • 5'Cap - transcriptional start site
  • PolyA
  • Splice5 - splice donor
  • Splice3 - splice acceptor
  • misc_transcribed

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the transcription feature.

variation

The variation category is used for features that relate to regions of the sequence that are polymorphic.

Features:

  • insertion
  • deletion
  • substitution
  • misc_variation

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the variation.

structural

The structural category is used for features that relate to mapping, sequencing and assembly, as well as for various landmarks that carry no intrinsic biological information.

Features:

  • clone
  • primer_left
  • primer_right
  • oligo
  • assembly_tag
  • misc_structural

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the structural feature.

similarity

The similarity category is used for areas that are similar to other sequences. Similarity features should have a <METHOD> tag that indicates the algorithm used for the sequence comparison, and a <TARGET> tag that indicates the target of the match.

Features:

  • NN -- nucleotide to nucleotide similarity (e.g. blastn)
  • NP -- nucleotide to protein similarity (e.g. blastx)
  • PN -- protein to nucleotide similarity (e.g. tblastn)
  • PP -- protein to protein similarity (e.g. tblastx)
  • misc_homology

repeat

The repeat category is used for areas that contain repetitive DNA. This category is used both for low-complexity regions, such as microsatellites, and for more biologically interesting features, such as transposon insertion sites.

Features:

  • microsatellite
  • inverted
  • tandem
  • transposable_element
  • LINE - long repeat not definitely identified as a transposon
  • misc_repeat

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the repetitive element.

experimental

The experimental category is a catchall used to flag areas where there is interesting experimental data of one sort or another. It is intended for use with high-throughput functional genomics work, such as knockouts or insertional mutagenesis screens.

Features:

  • knockout
  • expression_tag
  • microarrayed
  • RNAi_result
  • transgenic
  • mutant - a mutant phenotype associated with region
  • misc_experimental

It is recommended, but not required, that the <FEATURE> section contain <LINK> and/or <NOTE> tags that provide further information on the nature of the experimental data.

Glyph Types

This section describes a set of generic "glyphs" that can be used by sequence display programs to display the position of features on a sequence map. The annotation server may use these glyphs to send display suggestions to the viewer via the [#stylesheet stylesheet document].

The current set of glyph ID values are:

  • ARROW
  • ANCHORED_ARROW
  • BOX
  • CROSS
  • EX
  • HIDDEN
  • LINE
  • SPAN
  • TEXT
  • TOOMANY
  • TRIANGLE
  • PRIMERS

Each glyph has a set of attributes associated with it. Attribute values come in the following flavors:

INT
An integer
FLOAT
A floating point number (not currently used)
STRING
A text string
COLOR
A color. Colors can be specified using the "#RRGGBB" format commonly used in HTML, or as one of the 16 IBM VGA colors recognized by Netscape and Internet Explorer.
BOOL
A boolean value, either "yes" or "no".
FONT
A font. Any of the font identifiers recognized by Web browsers is acceptable, e.g. "helvetica".
FONT_STYLE
One of "bold", "italic", "underline".
LINE_STYLE
One of "hat", "solid", "dashed".

Some attributes are shared by all glyphs. Others are glyph-specific. The following attributes are shared in common:

HEIGHT
type: INT
The height of the glyph, in pixels. For the text font, this is equivalent to the FONTSIZE attribute.
FGCOLOR
type: COLOR
The foreground color of the glyph. This is the line and outline color for graphical glyphs, and the font color for text glyphs.
BGCOLOR
type: COLOR
The background color of the glyph. For hollow glyphs, such as boxes, this is the color of the interior of the box. For solid glyphs, such as text, this is ignored
LABEL
BOOL
Whether the glyph should be labeled with its name, as dictated by the <FEATURE> label attribute in the DASGFF document.
BUMP
BOOL
Whether the glyph should "bump" intersecting glyphs so that they do not overlap.

ARROW

A double-headed arrow with an axis either orthogonal or parallel to the sequence map.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

ANCHORED_ARROW

An arrow that has an arrowhead at one end, and an "anchor" (typically a diamond or line) at the other. The arrow points in the direction indicated by the <ORIENTATION> tag.

Attributes:

PARALLEL
type: BOOL
Arrows run either parallel ("yes") or orthogonal("no") to the sequence axis.

BOX

A rectangular box.

Attributes:

LINEWIDTH
type: INT
Width of the box outline.

CROSS

A cross "+". Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

DOT

A dot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

EX

"X" marks the spot. Common used for point mutations and other point-like features.

Attributes:

(no glyph-specific attributes)

HIDDEN

A feature that is invisible, intended to support semantic zooming schemes in which a feature is hidden at particular zooms.

Attributes: none.

LINE

A line. Lines are equivalent to arrows with both the northeast and southwest attributes set to "no".

Attributes:

STYLE
type: LINE_STYLE
The line type. A type of "hat" draws an inverted V (commonly used for introns). A type of "solid" draws a horizontal solid line in the indicated color. A type of "dashed" draws a dashed horizonal line in the indicated color.

SPAN

A spanning region, the recommended representation is a horizontal line with vertical lines at each end.

Attributes:

(no glyph-specific attributes)

TEXT

A bit of text.

Attributes:

FONT
type: FONT
The font.
FONTSIZE
type: INT
The font size.
STRING
type: STRING
The text to render.
STYLE
type: FONT_SYTLE
The style in which to render this glyph. Multiple FONT_STYLE attributes may be present.

PRIMERS

Two inward-pointing arrows connected by a line of a different color. Used for showing primer pairs and a PCR product. The length of the arrows is meaningless.

There are no glyph-specific attributes, but in this context the foreground color is the color of the arrows, and the background color is the color of the line that connects them.

TOOMANY

Too many features than can be shown. Recommended for use in consolidating sequence homology hits. The recommended visual presentation is a set of overlapping boxes.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.

TRIANGLE

A triangle. Commonly used for point mutations and other point-like features. The triangle is always drawn in the center of its range, but its width and height can be controlled by HEIGHT and LINEWIDTH respectively.

Attributes:

LINEWIDTH
type: INT
Width of the glyph.
DIRECTION
One of "N", "E", "S", and "W"

Other Issues

The distributed annotation system must have a mechanism for detecting and resolving version skew across reference and annotation servers. Although one such mechanism is currently incorporated into the ACeDB-based prototype, it is largely untested and hence not yet a part of the DAS standard.

Changes

Last modified: 08 Oct 2008
Retrieved from "http://biodas.open-bio.org/w/index.php?title=Spec_Review&oldid=575"