http://biodas.open-bio.org/w/index.php?title=Spec_Review&feed=atom&action=history
Spec Review - Revision history
2024-03-29T13:48:51Z
Revision history for this page on the wiki
MediaWiki 1.29.3
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=619&oldid=prev
Andy.jenkinson: /* Response: */
2008-10-30T14:23:02Z
<p><span dir="auto"><span class="autocomment">Response:</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 14:23, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l663" >Line 663:</td>
<td colspan="2" class="diff-lineno">Line 663:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. <font color="blue">DEPRECATE: </font>The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. <font color="blue">DEPRECATE: </font>The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>; <TYPE> (optional; zero or more per SEGMENT)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>; <TYPE> (optional; zero or more per SEGMENT)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), category (<font color="blue">required</font>) and <font color="blue">method (DEPRECATED)</font>. <font color="blue">The content of these correspond to the equivalent values in the '''Features Command'''.</font> The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. <font color="blue">Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.</font>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), category (<font color="blue">required</font>) and <font color="blue">method (DEPRECATED <ins class="diffchange diffchange-inline">- a method relates to a feature, not a type!</ins>)</font>. <font color="blue">The content of these correspond to the equivalent values in the '''Features Command'''.</font> The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. <font color="blue">Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.</font>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>----</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>----</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=618&oldid=prev
Andy.jenkinson: /* Response: */
2008-10-30T14:22:03Z
<p><span dir="auto"><span class="autocomment">Response:</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 14:22, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l644" >Line 644:</td>
<td colspan="2" class="diff-lineno">Line 644:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   <SEGMENT id="''id''" start="''start''" stop="''stop''" type="''type''" version="X.XX" label="''label''"></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   <SEGMENT id="''id''" start="''start''" stop="''stop''" type="''type''" version="X.XX" label="''label''"></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>       <TYPE id="''id1''" method="''method''" category="''category''">''Type Count 1''</TYPE></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>       <TYPE id="''id1''" <ins class="diffchange diffchange-inline"><font color="blue">DEPRECATED </ins>method="''method''"<ins class="diffchange diffchange-inline"></font> </ins>category="''category''">''Type Count 1''</TYPE></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>       <TYPE id="''id2''" method="''method''" category="''category''">''Type Count 2''</TYPE></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>       <TYPE id="''id2''" <ins class="diffchange diffchange-inline"><font color="blue">DEPRECATED </ins>method="''method''"<ins class="diffchange diffchange-inline"></font> </ins>category="''category''">''Type Count 2''</TYPE></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>   </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>       ...</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>       ...</div></td></tr>
<tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l663" >Line 663:</td>
<td colspan="2" class="diff-lineno">Line 663:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. <font color="blue">DEPRECATE: </font>The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>: The <SEGMENT> tag provides information on the reference segment. The '''id''', '''start''' and '''stop''' attributes indicate the coordinate system of the segment, and are required if the segment corresponds to a defined region of the genome, optional if the list of types corresponds to the entire database. The '''version''' attribute (required) indicates the current version of the sequence map. The optional '''label''' attribute supplies a human readable label for display purposes. <font color="blue">DEPRECATE: </font>The optional type attribute describes the segment type, for future compatibility with Sequence Ontology-based feature typing.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>; <TYPE> (optional; zero or more per SEGMENT)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>; <TYPE> (optional; zero or more per SEGMENT)</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), category (<font color="blue">required</font>) and method (<del class="diffchange diffchange-inline">optional</del>). <font color="blue">The content of these correspond to the equivalent values in the '''Features Command'''.</font> The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. <font color="blue">Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.</font>  </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>: Each segment has zero or more <TYPE> tags, which summarize the types of annotation available. The attributes are '''id''' (required), category (<font color="blue">required</font>) and <ins class="diffchange diffchange-inline"><font color="blue"></ins>method (<ins class="diffchange diffchange-inline">DEPRECATED</ins>)<ins class="diffchange diffchange-inline"></font></ins>. <font color="blue">The content of these correspond to the equivalent values in the '''Features Command'''.</font> The tag contents (optional) is a count of the number of features of this type across the segment, if one is specified in the request. <font color="blue">Servers treat method as being independent of the type, so should this be here?? IMO we can just remove it.</font>  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>----</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>----</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=617&oldid=prev
Andy.jenkinson: /* Clients */
2008-10-30T12:22:03Z
<p><span dir="auto"><span class="autocomment">Clients</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 12:22, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l97" >Line 97:</td>
<td colspan="2" class="diff-lineno">Line 97:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Display the annotations in the context of the sequence</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Display the annotations in the context of the sequence</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline"><font color="blue">This is best explained by diagram</font></del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">See this example in diagrammatic form: [[Media:Canonical_DAS_diagram_all.png|PNG image]]</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Client/Server Interactions==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==Client/Server Interactions==</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=616&oldid=prev
Andy.jenkinson: /* Clients */
2008-10-30T11:10:11Z
<p><span dir="auto"><span class="autocomment">Clients</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 11:10, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l92" >Line 92:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>A DAS client typically integrates data from a number of DAS servers, making use of the different data types. For example, a client might implement the following procedure for a particular sequence location:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>A DAS client typically integrates data from a number of DAS servers, making use of the different data types. For example, a client might implement the following procedure for a particular sequence location:</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div># Contact DAS registry to find reference and annotation servers for <del class="diffchange diffchange-inline">the relevant </del>assembly</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div># Contact DAS registry to find reference and annotation servers for <ins class="diffchange diffchange-inline">a particular genomic </ins>assembly</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Obtain sequence from the reference server</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Obtain sequence from the reference server</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Obtain sequence features from each of the annotation servers</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div># Obtain sequence features from each of the annotation servers</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=615&oldid=prev
Andy.jenkinson: /* Reference & Annotation Servers */
2008-10-30T11:07:44Z
<p><span dir="auto"><span class="autocomment">Reference & Annotation Servers</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 11:07, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l72" >Line 72:</td>
<td colspan="2" class="diff-lineno">Line 72:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><font color="blue">In future versions of the spec (i.e. those not focussed entirely on sequence) this will be generalised. That is, reference objects won't be assumed to be sequences and annotations won't be assumed to be sequence features.</font></div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><font color="blue">In future versions of the spec (i.e. those not focussed entirely on sequence) this will be generalised. That is, reference objects won't be assumed to be sequences and annotations won't be assumed to be sequence features.</font></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>'''Note:''' The distinction between reference and annotation servers is conceptual rather than physical. That is, a single server instance can in fact play both roles by offering <del class="diffchange diffchange-inline">offer </del>both sequences and annotations of those sequences.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>'''Note:''' The distinction between reference and annotation servers is conceptual rather than physical. That is, a single server instance can in fact play both roles by offering both sequences and annotations of those sequences.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''Note:''' A server may support multiple coordinate systems.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>'''Note:''' A server may support multiple coordinate systems.</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=614&oldid=prev
Andy.jenkinson: /* Coordinate Systems */
2008-10-30T11:05:58Z
<p><span dir="auto"><span class="autocomment">Coordinate Systems</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 11:05, 30 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l30" >Line 30:</td>
<td colspan="2" class="diff-lineno">Line 30:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Coordinate Systems===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===Coordinate Systems===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>A coordinate system is a stable, logical <del class="diffchange diffchange-inline">grouping </del>of reference objects. A coordinate system provides a mechanism to uniquely identify reference objects that share identifiers, such as chromosomes. For example, chromosome 21 might identify several reference objects from different species', but only one within the NCBI 36 human assembly. Thus, "human NCBI 36 chromosomes" is a coordinate system containing 25 reference objects.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>A coordinate system is a stable, logical <ins class="diffchange diffchange-inline">set </ins>of reference objects. A coordinate system provides a mechanism to uniquely identify reference objects that share identifiers, such as chromosomes. For example, chromosome 21 might identify several reference objects from different species', but only one within the NCBI 36 human assembly. Thus, "human NCBI 36 chromosomes" is a coordinate system containing 25 reference objects.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Coordinate systems are formally described using four properties:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Coordinate systems are formally described using four properties:</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* The '''category''' or type of annotatable entity. For example a chromosome <del class="diffchange diffchange-inline">sequence </del>or protein <del class="diffchange diffchange-inline">structure</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* The '''category''' or type of annotatable entity. For example a chromosome<ins class="diffchange diffchange-inline">, contig </ins>or protein <ins class="diffchange diffchange-inline">sequence</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The '''authority''' responsible for defining the coordinate system. For example NCBI or UniProt</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The '''authority''' responsible for defining the coordinate system. For example NCBI or UniProt</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The '''version''', for coordinate systems containing entities that are not versioned (e.g. genomic assemblies)</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* The '''version''', for coordinate systems containing entities that are not versioned (e.g. genomic assemblies)</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=613&oldid=prev
Jw12: /* Response: */
2008-10-28T11:41:38Z
<p><span dir="auto"><span class="autocomment">Response:</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 11:41, 28 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l556" >Line 556:</td>
<td colspan="2" class="diff-lineno">Line 556:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>&lt;DASSEQUENCE&gt;</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>&lt;DASSEQUENCE&gt;</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>   &lt;SEQUENCE id="id" start="start" stop="stop"</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>   &lt;SEQUENCE id="id" start="start" stop="stop"<ins class="diffchange diffchange-inline">></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>                </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>                </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>       atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>       atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat</div></td></tr>
</table>
Jw12
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=612&oldid=prev
Andy.jenkinson: /* The Response */
2008-10-16T09:50:56Z
<p><span dir="auto"><span class="autocomment">The Response</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 09:50, 16 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l141" >Line 141:</td>
<td colspan="2" class="diff-lineno">Line 141:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  Connection: close                             </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  Connection: close                             </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  Content-Type: text/plain                     </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  Content-Type: text/plain                     </div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Version: DAS/1.<del class="diffchange diffchange-inline">5</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Version: <ins class="diffchange diffchange-inline"><font color="blue"></ins>DAS/1.<ins class="diffchange diffchange-inline">6</font></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Status: 200</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Status: 200</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>  X-DAS-Capabilities: error-segment/1.0; unknown-segment/1.0; unknown-feature/1.0; ...</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=611&oldid=prev
Andy.jenkinson: /* The Request */
2008-10-16T09:50:19Z
<p><span dir="auto"><span class="autocomment">The Request</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 09:50, 16 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l124" >Line 124:</td>
<td colspan="2" class="diff-lineno">Line 124:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>The query string portion of the request (the "?" symbol rightward) can be POSTed to the URL following conventional HTTP standards. Since some queries can be quite large, this is the recommended way of argument passing.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>'''<del class="diffchange diffchange-inline"><font color="red">SOAP has not been widely adopted for das so should we delete this?</font></del><font color="blue"><del class="diffchange diffchange-inline">Yep!</font>''' </del>The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>'''<font color="blue"><ins class="diffchange diffchange-inline">DELETE: </ins>The request may be replaced with a SOAP-style XML-encapsulated document in future versions of this specification.<ins class="diffchange diffchange-inline"></font></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===The Response===</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>===The Response===</div></td></tr>
</table>
Andy.jenkinson
http://biodas.open-bio.org/w/index.php?title=Spec_Review&diff=610&oldid=prev
Andy.jenkinson: /* The Queries */
2008-10-16T09:48:57Z
<p><span dir="auto"><span class="autocomment">The Queries</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr style='vertical-align: top;' lang='en'>
<td colspan='2' style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black; text-align: center;">Revision as of 09:48, 16 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l258" >Line 258:</td>
<td colspan="2" class="diff-lineno">Line 258:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==The Queries==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>==The Queries==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as ''PREFIX''.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>This section lists the queries recognized by reference and annotation servers. Each of these queries begins with some site-specific prefix, denoted here as ''PREFIX''. <ins class="diffchange diffchange-inline">The other meta-variable used in these examples is ''DSN'', which is a symbolic data source (as seen in the [#request  above example.])</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><font color="blue">At present, there is no implementation of the "assembly traversal' features of DAS. In the interests of simplicity, we could opt for removing this capacity. This would involve removing:</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div><font color="blue">At present, there is no implementation of the "assembly traversal' features of DAS. In the interests of simplicity, we could opt for removing this capacity. This would involve removing:</div></td></tr>
</table>
Andy.jenkinson