The Lightweight Distributed Annotation Server (LDAS) |
|
Resources Lightweight DAS Server Related Projects |
THE LIGHTWEIGHT DAS SERVERThe Lightweight DAS Server (LDAS) is designed for use by small to medium sites. It is ``lightweight'' in the sense that once all the software is installed, annotations can be loaded and updated using tab-delimited text files. It uses only open source (free) software, and does not require a deep knowledge of database design or of the DAS protocol itself. This server is capable of serving annotations on up to several million features across eukaryotic genomes. It runs on top of the Mysql database engine, the Apache web server, and the Perl programming language. It is designed to be portable between all flavors of Unix and Microsoft Windows.
PREREQUISITESThe following software is required to run the LDAS: 1) Apache web server 1.3.17 or higher
Home page http://www.apache.org
Source code http://httpd.apache.org/dist/httpd/apache_1.3.22.tar.gz
RedHat RPM to come
2) Mysql version 3.23 or higher
Home page http://www.mysql.org
Source/binaries http://www.mysql.com/downloads/mysql-3.23.html
RedHat RPM to come
3) Perl 5.6.1 or higher
Home page http://www.cpan.org
Source code http://www.cpan.org/src/stable.tar.gz
RedHat RPM to come
4) Perl DBI module 1.20 or higher
Home page http://www.cpan.org
Source code http://www.cpan.org/modules/by-module/DBI/DBI-1.20.tar.gz
5) Perl DBD module 1.22 or higher
Home page http://www.cpan.org
Source code http://www.cpan.org/modules/by-module/DBD/
Msql-Mysql-modules-1.2216.tar.gz
3) Bio::DB::GFF version 0.38 or higher
Home page http://www.bioperl.org
This is part of the "live" bioperl 0.9.X distribution.
See below for instructions on getting the most recent
version.
In addition, the following is recommended for those who wish to dramatically increase the performance of their system: 4) Mod_perl version 1.24 or higher
Home page http://perl.apache.org
Source code http://www.cpan.org/modules/by-module/Apache/mod_perl-1.26.tar.gz
RedHat RPM mod_perl-1.25-2cl.i386.rpm
5) Apache::DBI 0.88 or higher
Home page (none)
Source code http://www.cpan.org/modules/by-module/Apache/ApacheDBI-0.88.tar.gz
RedHat RPM to come
Note that many Linux systems will have (1), (2) and (3) installed already. To install the RPM versions of these packages, use the ``rpm'' command or an RPM graphical front end if you have one. To install the source code versions, unpack them with the following command (Unix style): % gunzip -c the-package.tar.gz | tar xvf - This will unpack to one or more directories, at the top of which will be a README or INSTALL file. Follow these instructions to build and install the packages.
Installing Bio::DB::GFFIt is a bit tricky to install Bio::DB::GFF since it is currently part of the development version of bioperl and not directly downloadable as a nice package. You must use anonymous CVS to get this package. Here is the recipe (copied from http://cvs.bioperl.org):
(1) Make sure that CVS is installed on your system.
(2) Use the following command (all on one line) to login to the server
% cvs -d :pserver:cvs@cvs.bioperl.org:/home/repository/bioperl login
when prompted, the password is 'cvs'
(3) Check out the bioperl package you are interested in, for most
users this will be the bioperl-live source tree. The following
command should be executed as one line.
% cvs -d :pserver:cvs@cvs.bioperl.org:/home/repository/bioperl checkout bioperl-live
The login and checkout procedure should only have to be done
once. To update the source directories in the future it should be
possible just to enter the top level directory and issue the
following command:
% cvs update
This will create the directory ``bioperl-live''. Now build and install bioperl with the following recipe:
% cd bioperl-live
% perl Makefile.PL
% make
% make test
% make install
The last step will probably need to be run as root.
INSTALLING THE LDASThe lightweight DAS server itself is a small Perl script that runs on top of the Bio::DB::GFF Perl library. The architecture looks like this:
das script <--> Apache ---------------> Das Client
|
Bio::DB::GFF
|
mysql
1) Before you install LDAS, identify the location of the Apache web server's CGI and configuration directories. Also identify the location in which you would like to place the scripts that load the mysql database from flat files. Typical locations are: Configuration directory: /usr/local/apache/conf CGI script directory: /usr/local/apache/cgi-bin Load script directory: /usr/local/bin Users of Apache/mod_perl should indicate the location of their Apache::Registry scripts directory for the CGI scripts. This is /usr/local/apache/cgi-perl on many systems, but it depends on how you have configured mod_perl. If you change your mind about these locations later, you may reinstall, or just manually move the files around. 2) From within the LDAS directory, run ``perl Makefile.PL'': % perl Makefile.PL You will be asked to indicate the locations of the configuration directory, CGI script directory, and scripts directory. Enter your choices. 3) Make, test and install the LDAS: % make % make test % make install You may have to be root to run the last step. Currently the ``test'' step only confirms that you have installed Bio::DB::GFF. This will copy the contents of the LDAS distribution's ``bin'' subdirectory to the CGI scripts directory, the contents of the ``conf'' subdirectory to the Apache configuration directory, and the contents of ``scripts'' to the load script directory.
Manual InstallIf you are using a Microsoft Windows machine without access to ``make'', or you run into problems during the install, here is how to do the install manually: 1) Enter the scripts subdirectory and run Perl on each of the .PLS files you find there: % cd scripts % perl Das2GFF.PLS % perl ldas_load.plS % perl ldas_bulk_load.plS This will create three .pl files, each configured for your system. Manually copy them into a directory where you keep executable files and scripts. 2) Enter the bin subdirectory and run Perl on the das.PLS file, passing it the path to the configuration directory. For example: % cd bin % perl das.PLS C:\Apache\conf This will create the file ``das.pl''. Rename it ``das'' and copy it into your CGI scripts directory: % copy das.pl C:\Apache\cgi-bin\das 3) Enter the conf subdirectory and copy all the files you find there into the chosen configuration directory: % cd conf % copy * C:\Apache\conf\das.conf\
SETTING UP THE DATABASEYou will need to create one Mysql database for each data source that you wish to serve. The same database can be used for annotations and reference information.
Creating the DatabaseThe database must be writable by you, and readable by the user that Apache runs as (usually the ``nobody'' user). In addition, if you wish to use the fast file-based bulk loader, you will have to have FILE privileges on the server. The following illustrates the steps in setting up a new database called ``dicty'':
The first grant command in this example show all privileges (select, update, create, delete) being granted to users who log in as ``lstein'' from the local machine. You will want to change the user name to your own login. The second grant command grants file permissions to this user so that he can use the bulk loader. Because of the way Mysql's bulk loading works, the file permission must be granted to all databases (*.*) and not just to a single one. The third command grants select permissions to the ``nobody'' user. This enables the web server script to read the dicty database, but not to update or otherwise change it. You may wish to add password protection to the database. If you do this for the ``nobody'' user, you will need to update the ``user'' and ``passwd'' settings in the configuration file.
Creating the Load FilesThe LDAS database is loaded from tab-delimited files containing annotation and assembly information. There are actually three types of tables that can be loaded:
In practice, you can use a different file for each of the reference point, assembly, and annotation tables, put all the information into different sections of a single file, or distribute the information arbitrarily among multiple files. Load files are plain, tab-delimited text files, such as can be produced by a text editor or a spreadsheet program. The files must have the extension .das. The different types of information are proceeded by a short bracketed identifier. Here is an excerpt from the ``test.das'' file that is included with this distribution: [references] #id class length Chr1 Chromosome 10000 Link_1 Link 6000 Link_2 Link 5000 Cont_1a Contig 5000 Cont_1b Contig 5000 Cont_2a Contig 9000 Cont_2b Contig 8000 [assembly] #id start end class name start end Chr1 1 5000 Link Link_1 1001 6000 Chr1 5001 10000 Link Link_2 2001 7000 Link_1 1001 3500 Contig Cont_1a 1 2500 Link_1 3501 5000 Contig Cont_1b 4500 2001 Link_1 5001 6000 Contig Cont_1a 5000 4001 Link_2 2001 4500 Contig Cont_2a 1001 3500 Link_2 4501 7000 Contig Cont_2b 8000 5501 [annotations] #class name type subtype ref start stop strand phase score tstart tend Gene abc-1 exon curated Cont_2a 5050 5100 + . . Gene abc-1 CDS curated Cont_2a 5060 5100 + 0 . Gene abc-1 exon curated Cont_2a 5200 5280 + . . Gene abc-1 CDS curated Cont_2a 5200 5280 + 2 . Gene abc-1 exon curated Cont_2a 5300 5380 + . . Gene abc-1 CDS curated Cont_2a 5300 5360 + 2 . EST yk123.1 similarity ESTWise Cont_2a 5025 5100 . . 99 1 76 EST yk123.1 similarity ESTWise Cont_2a 5200 5280 . . 99 77 157 . . repeat alu Cont_2a 5050 5150 . . 80 As shown in the example, the file is divided into multiple sections, each containing a bracketed [section] identifier. There can be multiple sections in a single load file, or you can create a file that contains a single section only. Blank lines, and lines that begin with the # sign, are ignored. All columns must be separated by tabs, not spaces.
You can create these data files using any text editor or spreadsheet program, but be sure to save the results as text only, using tabs to delimit the columns. The data files must have the extension .das, and must begin with one of the section identifiers [references], [assembly] or [annotations]. A file can contain several different sections, and can in fact switch back and forth between them. The expressivity of the annotations table is limited by the fact that an annotation can only belong to a single group. To express more complex relationships, you must factor out intermediate groups. For example, consider a gene that is composed of two alternative transcripts, each of which is composed of a different subset of four exons:
Exon1 Exon2 Exon3 Exon4
transcript a x x x
transcript b x x x
Under current restrictions, you will have to express these relationships by creating two named Transcript objects, which overlap in range with a Gene object. Exons 1 and 3 will be duplicated in the table: Gene abc-1 curated gene Cont_2a 5050 5380 ... Transcript abc-1a curated transcript Cont_2a 5050 5380 ... Transcript abc-1b curated transcript Cont_2a 5050 5280 ... Transcript abc-1a curated exon Cont_2a 5050 5100 ... Transcript abc-1a curated exon Cont_2a 5200 5280 ... Transcript abc-1a curated exon Cont_2a 5300 5380 ... Transcript abc-1b curated exon Cont_2a 5050 5100 ... Transcript abc-1b curated exon Cont_2a 5050 5100 ... Transcript abc-1b curated exon Cont_2a 5200 5280 ... This restriction will be lifted in the DAS/2 server, which will allow much more expressive grouping of annotations.
Loading the DatabaseThere are two database loaders provided with the LDAS distribution:
To load the data, first make sure that the Mysql server is running, and that you have created the database using ``mysqladmin create'' as described earlier. Assume that the database is named ``dicty'' and the file containing its annotations is in ``dicty.das''. Then you can load the database with ldas_load.pl with the following command: % ldas_load.pl --create --database dicty dicty.das The b<--create> option initializes the database, loading the LDAS schema and deleting any conflicting tables. The b<--database> option specifies the database to load. You can use the abbreviated form ``dicty'' to load the local database named dicty, or the full form to load a remote database:
dbi:mysql:dicty:remote_hostname
The script provides b<--user> and b<--pass> options if you need to specify a username and password for the database. These options can be abbreviated as b<-c>, b<-d> and so on. Call the script with the b<--help> option for more usage information. If the data is distributed among multiple files, you can load them in one fell swoop like this: % ldas_load.pl --create --database dicty dicty1.das dicty2.das dict3.das... With the ldas_load.pl script (but not the bulk loader!) you can load the database incrementally, adding the contents of additional data files as needed. If you try to load the same file twice, you will see many ``duplicate key'' errors. This is harmless. All options can be abbreviated to single-letter options. For example, you can use -d instead of --database, and -c instead of --create. The ldas_bulk_load.pl is called in the same way with the same arguments. However, it b<always> reinitializes the database, throwing out whatever was there before. Ordinarily the script will warn you when it is about to do this and gives you a chance to abort. In this case, the b<--create> option simply turns off this warning. Do not try to use ldas_bulk_load.pl to load a remote database or to perform an incremental load. It won't work. There is a very small test data set included in this distribution in the subdirectory ``testdata.''
Testing the DatabaseThe distribution comes with a simple database dumper and query script named ldasdump.pl. Run it with the b<-h> argument to see the usage. If you've used the test data to load the ``dicty'' database, you can dump out the entire contents of the database like this: % ldasdump.pl --database test Sequence Chr1 Chromosome Component Chr1 1 10000 +1 Sequence Link_1 Link Component Link_1 1 6000 +1 Sequence Link_1 Link Component Chr1 1 5000 +1 1001 6000 Sequence Link_2 Link Component Link_2 1 7000 +1 ... Notice that the data does not come out in exactly the same format as it went in. In particular, the various reference sequences and their components appear as various features of type ``Component.'' To extract a certain set of feature types, use the b<--type> argument. For example: % ldasdump.pl -d dicty --type exon,intron Gene abc-1 curated exon Cont_2a 5300 5380 +1 Gene abc-1 curated exon Cont_2a 5200 5280 +1 Gene abc-1 curated exon Cont_2a 5050 5100 +1 To extract a range, for example, everything on contig Cont_2a from
position 5000 to 5200, list the % ldasdump.pl -d dicty Cont_2a:5000,5200 Sequence Cont_2a Component Contig Cont_2a 1 9000... Gene abc-1 exon curated Cont_2a 5050 5100 ... Gene abc-1 CDS curated Cont_2a 5060 5100 ... Gene abc-1 exon curated Cont_2a 5200 5280 ... Gene abc-1 CDS curated Cont_2a 5200 5280 ... EST yk123.1 similarity ESTWise Cont_2a 5025 5100 ... EST yk123.1 similarity ESTWise Cont_2a 5200 5280 ... . . repeat alu Cont_2a 5050 5150 ... The query will find everything that overlaps the specified range. The --type and range arguments can be combined. If you have the Bio::Graphics module installed (see http://www.gmod.org), you can use the -g option to generate a GIF or PNG file of the region, which can then be piped to your favorite image viewer. For example, % ldasdump.pl -g -d dicty Cont_2a:5000,5200 | display -
Setting Up the FASTA File Directory (reference servers only)If you are running a DAS reference server, the server will be called on to serve up segments of the genomic DNA. Mysql databases do not handle large segments of DNA well, so LDAS keeps the DNA in external FASTA files. Select a directory to contain the DNA files. It should be on the same machine that the web server runs, and in a directory that is writable by the web server user (usually ``nobody''). The reason for this is that the very first time the LDAS server needs DNA information, it will construct an index of the contents of the directory and store it in an index file. Thereafter, access to arbitrary sections of DNA will be very fast. This functionality uses Bioperl's Bio::DB::Fasta module, which in terms runs on top of Perl's hash databases. The FASTA files should contain one entry for each sequenced segment of the genome. These are the lowest-level assembly units listed in the [references] section of the annotation load files, typically corresponding to sequenced clones or to the contigs of a whole genome shotgun effort. In our toy ``dicty'' example the lowest-level entry is Contig. So the FASTA files should contain entries for Cont_1a, Cont_1b, Cont_2a and so forth: >Cont_1a cgagtatgtcctcaaaaagaagggatggccacaagacagaggtattcttaaaccggacca agcggttatccgccgtcacgccgcttgtgcctatgactcgaggtcgcgcacgcagggtat gcgtctttatgcatctgcgttgaacctatagtcaatgctgatatcgttggatgtttatat ... >Cont_1b tggaggggctctgttaagttttactgatcacacaggttatcgattggtacgcgtatcttg cagtggcggcgaatgtagcttaggtgggaacgttataaagttgagggattaagatattat gagagttcctgaaggccgctgccacggaatctcacgtaagacccaccgaagactaattgg ... All the DNAs can be in a single FASTA file, or can be split up among several files for convenience. The FASTA files must then be placed in the designated directory. In the example, we will assume that you wish to place the FASTA files into /var/fasta/dicty. % cd /var % mkdir -p fasta/dicty % chgrp nobody fasta/dicty % chmod g+w fasta/dicty % cp ~/dicty_genome/*.fasta /var/fasta/dicty
CONFIGURING LDAS TO SERVE ANNOTATIONSThe installation steps will install a single Perl script, named ``das'', in Apache's CGI directory. The exact location of this script depends on the CGI script directory path selected when LDAS was installed, but it is /usr/local/apache/cgi-bin/das by default. DAS clients issue requests to the CGI script by appending the selected data source and desired command to the end of the URL, as in: http://www.yourhost.org/cgi-bin/das/dicty/entry_points In this example, the data source is ``dicty'' and the command is ``entry_points''. There may also be CGI parameters appended to the URL, as in: http://www.yourhost.org/cgi-bin/das/dicty/features?segment=Cont_1a:1,5000 (www.yourhost.org is the name of the machine that is running the web server.) The ``data_source'' part of the URL is a symbolic name used to refer to the database. For example, if your annotation data set corresponds to the dictyostelium genomic assembly, you could choose ``dicty'' as the symbolic name, and refer to the annotations as: http://www.yourhost.org/cgi-bin/das/dicty/command If there are several releases of the genome, each with a different version number, it is suggested that you append the version number to the symbolic name, as in ``dicty3''. Before the script can start serving annotations, it needs to be configured to handle the annotation data set. This involves creating a custom configuration file. The LDAS configuration styles are stored in the directory selected during the installation process, /usr/local/apache/conf/das.conf by default. They are named using data source with ``.conf'' appended, as in ``dicty.conf''. A number of sample .conf files are installed: ``test.conf'' is a simple configuration file suitable for use as a template when creating your own sources. ``elegans.conf'' is a more complicated sample configuration used by the C. elegans WormBase database. To configure a new data source, create a new .conf file from the ``test.conf'' template: % cp test.conf dicty.conf Now edit the .conf file in your favorite text editor, changing the configuration options as appropriate. The configuration file is divided into a number of sections, each one introduced by a [SECTION] title. Each [SECTION] has one or more options. An option consists of a option name, and one or more option values. The general format is this: option_name = option_value1 option_value2 We'll now walk through the configuration file. Please refer to the test.conf file during this walkthrough.
LDAS also install a configuration file named elegans.conf, which is a richer set of definitions used by the WormBase LDAS server. You will probably want to remove it from das.conf before you take your server live.
Configuring the Stylesheet (annotation servers only)DAS allows annotation servers to provide hints to DAS browsers as to how the various annotations should be rendered graphically. The hints are known as a stylesheet. LDAS keeps its stylesheets in the das.conf directory, in a file named ``source.style'', where ``source'' is the name of the data source. For example, the stylesheet for the example ``dicty'' database will be named ``dicty.style.'' You do not need to create a specialized stylesheet to run an annotation server. The default stylesheet, which is contained in the file ``default.style'' contains a reasonable set of defaults (and will be updated regularly as the DAS data model evolves). However, if you wish to customize the stylesheet, here is an excerpt from default.style with a description of how it works: [default] glyph = box bump = 0 bgcolor = cyan fgcolor = black font = sanserif [component] glyph = anchored_arrow [transcription:high] bump = 1 [transcription:low] bump = 0 [transcript:high] bump = 1 connector = hat [transcript:low] bump = 0 connector = solid The stylesheet is divided into multiple bracketed [sections] just like the configuration files. Each section contains attribute/value pairs that describe how a set of annotations are to be rendered. The [default] section is special, and provides global defaults used for all annotation types. Other [sections] contain either a category name or a specific annotation type. For example, this will set the appearance of all annotations of category ``transcription'': [transcription] This will set the appearance of all annotations of type ``intron'': [intron] This will set the appearance of all annotations of type ``intron'', subtype ``curated'': [intron:curated] This will set the appearance of annotations of type ``intron'', subtype ``curated'', at high magnification: [intron:curated:high] and this will set the appearance at low magnification: [intron:curated:low] The definitions of ``high'' and ``low'' are DAS browser-dependent. High magnifications are those in which the density of features is low enough to distinguish individual features. Low magnifications are those in which features are densely packed. It is also possible to assign rendering attributes to a class of group. Just use the group class in the [section]. [Gene] There is the possibility of collision between the naming of categories, annotation types, and group classes. In case of collision, the priority is: annotation type, group class, category. Within a configuration section are a number of attribute=value pairs. The full listing of the various attributes and their values are described in the DAS specification: http://www.biodas.org/documents/spec.html#glyphid. The most frequently used attributes are:
TESTING THE LDAS SERVERIf you have loaded up the ``dicty'' database with the contents of the test.das load file and configured the dicty.conf file as described earlier, you should be able to make queries on the web server. You can do this with your favorite web browser.
Testing the DSN commandFetch the URL http://www.your.site/cgi-bin/das/dsn. You should get a screen like this one: <?xml version="1.0" standalone="yes"?> <!DOCTYPE DASDSN SYSTEM "http://www.biodas.org/dtd/dasdsn.dtd";> <DASDSN> <DSN> <SOURCE id="dicty">dicty</SOURCE> <MAPMASTER>http://www.test.org/db/das/dicty<;/MAPMASTER> <DESCRIPTION>Test annotations</DESCRIPTION> </DSN> <DSN> <SOURCE id="elegans">elegans</SOURCE> <MAPMASTER>http://www.wormbase.org/db/das/elegans<;/MAPMASTER> <DESCRIPTION>C. elegans annotations on chromosome I & II</DESCRIPTION> </DSN> <DSN> <SOURCE id="test">test</SOURCE> <MAPMASTER>http://www.test.org/db/das/test<;/MAPMASTER> <DESCRIPTION>Test annotations</DESCRIPTION> </DSN> </DASDSN> There should be one <DSN> section for each configuration file in the das.conf directory.
Testing the entry_points commandFetch the URL http://www.your.site/cgi-bin/das/dicty/entry_points You should get a list of entry points that looks like this: <?xml version="1.0" standalone="no"?> <!DOCTYPE DASEP SYSTEM "http://www.biodas.org/dtd/dasep.dtd";> <DASEP> <ENTRY_POINTS href="http://localhost/perl/das/dicty/entry_points"; version="1.0"> <SEGMENT id="Chr1" size="10000" start="1" stop="10000" class="Sequence" orientation="+" subparts="no">Chr1</SEGMENT> <SEGMENT id="Link_1" size="6000" start="1" stop="6000" class="Sequence" orientation="+" subparts="no">Link_1</SEGMENT> <SEGMENT id="Link_2" size="7000" start="1" stop="7000" class="Sequence" orientation="+" subparts="no">Link_2</SEGMENT> <SEGMENT id="Cont_1a" size="5000" start="1" stop="5000" class="Sequence" orientation="+" subparts="no">Cont_1a</SEGMENT> <SEGMENT id="Cont_1b" size="5000" start="1" stop="5000" class="Sequence" orientation="+" subparts="no">Cont_1b</SEGMENT> <SEGMENT id="Cont_2a" size="9000" start="1" stop="9000" class="Sequence" orientation="+" subparts="no">Cont_2a</SEGMENT> <SEGMENT id="Cont_2b" size="8000" start="1" stop="8000" class="Sequence" orientation="+" subparts="no">Cont_2b</SEGMENT> </ENTRY_POINTS> </DASEP>
Testing the features commandFetch the URL http://www.your.site/cgi-bin/das/dicty/features?segment=Cont_1a;type=RNAi You should get information on the single RNAi experiment that overlaps Contig Cont_1a: <?xml version="1.0" standalone="yes"?> <!DOCTYPE DASGFF SYSTEM "http://www.biodas.org/dtd/dasgff.dtd";> <DASGFF> <GFF version="1.01" href="http://localhost/perl/das/dicty/features?segment=Cont_1a;type=RNAi"> <SEGMENT id="Cont_1a" start="1" stop="5000" version="1.0"> <FEATURE id="exper1" label="exper1"> <TYPE id="RNAi" category="experimental">RNAi</TYPE> <METHOD id="RNAi">RNAi</METHOD> <START>1</START> <END>2500</END> <SCORE>-</SCORE> <ORIENTATION>+</ORIENTATION> <PHASE>0</PHASE> <GROUP id="exper1" /> </FEATURE> </SEGMENT> </GFF> </DASGFF>
Testing the types commandFetch the URL http://www.your.site/cgi-bin/das/dicty/types. This should return the list of all annotation types contained in the database: <?xml version="1.0" standalone="yes"?> <!DOCTYPE DASTYPES SYSTEM "http://www.biodas.org/dtd/dastypes.dtd";> <DASTYPES> <GFF version="1.2" summary="yes" href="http://localhost/perl/das/dicty/types?enumerate=1";> <SEGMENT> <TYPE id="similarity:ESTWise" category="similarity" method="similarity" source="ESTWise" /> <TYPE id="repeat:alu" category="miscellaneous" method="repeat" source="alu" /> <TYPE id="RNAi" category="experimental" method="RNAi" source="" /> <TYPE id="Component:Contig" category="structural" method="Component" source="Contig" /> <TYPE id="exon:curated" category="transcription" method="exon" source="curated" /> <TYPE id="CDS:curated" category="translation" method="CDS" source="curated" /> <TYPE id="Component:Link" category="structural" method="Component" source="Link" /> <TYPE id="Component:Chromosome" category="structural" method="Component" source="Chromosome" /> </SEGMENT> </GFF> </DASTYPES>
What to do next?If your LDAS server is serving annotations on the Homo sapiens assembly used by the Ensembl server, then you should be able to add the URL of your LDAS server to Ensembl's contig display (http://www.ensembl.org). Bring up the contig display for a region of the genome covered by your annotations, select ``Das Sources'' from the menu, and add the URL for your DAS source, using the proper address for your hostname, and the appropriate data source name (not ``dicty''!): e.g. http://www.your.site/cgi-bin/das/your_source. Your annotations should now appear on the Ensembl display. If your LDAS server is serving annotations on the C. elegans database using the WormBase assembly, please contact Lincoln Stein (lstein@cshl.org), and he will add your server URL to the list used by the C. elegans ``genome hunter'' display (http://www.wormbase.org). For other organisms, contact the maintainer of the appropriate reference server (a list will be going up on http://www.biodas.org in early November). If you are running a reference server, you may be able to use either Robin Dowell's Geodesic or Matthew Pocock's das-client application to view your data. However, at the time this was written, the Geodesic client was being updated to accomodate a few last-minute, but important changes to the DAS specification.
Notes for mod_perl UsersIf you use the combination of Apache and mod_perl, performance of the LDAS server will be improved dramatically. This is because mod_perl allows the connection between the database and the das CGI script to remain active even when the script is not actively serving data. To use LDAS with mod_perl, configure an Apache::Registry directory in the way described by the mod_perl documentation. Briefly: Alias /perl/ /usr/local/apache/cgi-perl/ <Location /perl> SetHandler perl-script PerlHandler Apache::Registry PerlSendHeader On Options +ExecCGI </Location> Copy the das script from the cgi-bin directory into the cgi-perl directory so that it is recognized and run by Apache::Registry. The last step is to tell the das script where to find its configuration files. Create a <Location> section that configures a mod_perl variable named DasConfigFile:
<Location /perl/das>
PerlSetVar DasConfigFile conf/das.conf
</Location>
If this section is not present, the das script will look in the location specified at installation time. It is a hard-wired variable located towards the top of the das script.
BUG REPORTSPlease report bugs to lstein@cshl.org and to the DAS mailing list: das@ebi.ac.uk
LICENSE AND DISCLAIMERThe LDAS package and all associated files are Copyright (c) 2001 Cold Spring Harbor Laboratory. This library is free software; you can redistribute it and/or modify it under the same terms as Perl itself. See the Artistic License file in the main Perl distribution for specific terms and conditions of use. In addition, the following disclaimers apply: CSHL makes no representations whatsoever as to the SOFTWARE contained herein. It is experimental in nature and is provided WITHOUT WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE OR ANY OTHER WARRANTY, EXPRESS OR IMPLIED. CSHL MAKES NO REPRESENTATION OR WARRANTY THAT THE USE OF THIS SOFTWARE WILL NOT INFRINGE ANY PATENT OR OTHER PROPRIETARY RIGHT. By downloading this SOFTWARE, your Institution hereby indemnifies CSHL against any loss, claim, damage or liability, of whatsoever kind or nature, which may arise from your Institution's respective use, handling or storage of the SOFTWARE. If publications result from research using this SOFTWARE, we ask that CSHL be acknowledged and/or credit be given to CSHL scientists, as scientifically appropriate. |